Incidental Mutation 'R1800:Dab2'
ID203083
Institutional Source Beutler Lab
Gene Symbol Dab2
Ensembl Gene ENSMUSG00000022150
Gene Namedisabled 2, mitogen-responsive phosphoprotein
Synonyms5730435J12Rik, p96, D630005B22Rik, D15Wsu122e
MMRRC Submission 039830-MU
Accession Numbers

Genbank: NM_023118, NM_001008702, MGI: 109175

Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R1800 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6299788-6440712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6435467 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 361 (M361L)
Ref Sequence ENSEMBL: ENSMUSP00000124589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078019] [ENSMUST00000080880] [ENSMUST00000110663] [ENSMUST00000110664] [ENSMUST00000161812]
Predicted Effect probably benign
Transcript: ENSMUST00000078019
AA Change: M382L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077166
Gene: ENSMUSG00000022150
AA Change: M382L

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000080880
AA Change: M600L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079689
Gene: ENSMUSG00000022150
AA Change: M600L

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 488 506 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 553 573 N/A INTRINSIC
low complexity region 596 612 N/A INTRINSIC
PDB:3H8D|H 683 711 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110663
AA Change: M382L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106291
Gene: ENSMUSG00000022150
AA Change: M382L

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110664
AA Change: M579L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106292
Gene: ENSMUSG00000022150
AA Change: M579L

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 467 485 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
PDB:3H8D|H 662 690 3e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159552
Predicted Effect probably benign
Transcript: ENSMUST00000161812
AA Change: M361L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124589
Gene: ENSMUSG00000022150
AA Change: M361L

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 249 267 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
low complexity region 314 334 N/A INTRINSIC
low complexity region 357 373 N/A INTRINSIC
PDB:3H8D|H 444 472 2e-12 PDB
Predicted Effect unknown
Transcript: ENSMUST00000163082
AA Change: M467L
SMART Domains Protein: ENSMUSP00000124996
Gene: ENSMUSG00000022150
AA Change: M467L

DomainStartEndE-ValueType
Blast:PTB 2 59 1e-33 BLAST
PDB:1P3R|C 2 59 2e-34 PDB
SCOP:d1ddma_ 3 59 9e-12 SMART
low complexity region 60 79 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 441 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
PDB:3H8D|H 551 579 3e-12 PDB
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitogen-responsive phosphoprotein. It is expressed in normal ovarian epithelial cells, but is down-regulated or absent from ovarian carcinoma cell lines, suggesting its role as a tumor suppressor. This protein binds to the SH3 domains of GRB2, an adaptor protein that couples tyrosine kinase receptors to SOS (a guanine nucleotide exchange factor for Ras), via its C-terminal proline-rich sequences, and may thus modulate growth factor/Ras pathways by competing with SOS for binding to GRB2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants exhibit abnormal primitive endoderm structure and/or function, lack a proamniotic cavity and die prior to embryonic day 9.5. A conditional mutant survives, but shows kidney proximal tubule abnormality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,718 K556R probably damaging Het
4933406P04Rik A T 10: 20,311,147 probably benign Het
A530099J19Rik T C 13: 19,729,679 noncoding transcript Het
Acmsd C A 1: 127,759,756 Y258* probably null Het
Adgrf5 A T 17: 43,451,082 I1223F probably damaging Het
Afp C T 5: 90,490,796 P6S probably benign Het
Agap2 C A 10: 127,091,671 H1120Q probably damaging Het
Angpt1 A G 15: 42,512,404 V152A probably damaging Het
Ankrd1 A T 19: 36,119,359 F23I probably damaging Het
Armc12 T C 17: 28,538,895 S334P possibly damaging Het
Arnt2 C A 7: 84,275,375 D415Y probably damaging Het
Cacna1s G T 1: 136,076,854 V131L probably benign Het
Cacna2d2 T C 9: 107,527,433 V1141A possibly damaging Het
Cfap61 T C 2: 146,042,622 L580P probably damaging Het
Chga A T 12: 102,555,905 S23C probably damaging Het
Chrna5 A G 9: 55,004,875 T320A probably damaging Het
Col17a1 G T 19: 47,650,862 N1081K possibly damaging Het
Cox7b2 A T 5: 71,443,063 C51S possibly damaging Het
Cwc22 A T 2: 77,929,453 D83E possibly damaging Het
D130043K22Rik A C 13: 24,883,894 D871A probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnmbp A G 19: 43,901,720 I536T probably benign Het
Ehmt1 A T 2: 24,884,290 S43R probably damaging Het
Ercc5 T C 1: 44,173,380 L666P probably benign Het
F5 A G 1: 164,182,834 H378R probably damaging Het
Fam84a T C 12: 14,150,225 Y167C probably damaging Het
Fat2 A T 11: 55,283,892 N1998K probably damaging Het
Fbxo28 T C 1: 182,341,534 D13G unknown Het
Fras1 T C 5: 96,709,882 S2012P probably benign Het
Gm4758 T A 16: 36,312,533 D57E probably damaging Het
Gm5624 T A 14: 44,561,845 N41I probably damaging Het
Gm6768 A T 12: 119,261,771 noncoding transcript Het
Gm8104 A G 14: 43,101,571 I73V possibly damaging Het
Gpr68 G A 12: 100,878,908 P126S probably damaging Het
Gucy1a2 A T 9: 3,582,685 T156S possibly damaging Het
Hacl1 T A 14: 31,614,264 Y429F probably damaging Het
Haus3 A C 5: 34,163,572 L510R probably damaging Het
Helq C T 5: 100,774,124 G738D probably benign Het
Hsd3b2 G C 3: 98,712,237 P131A probably damaging Het
Il22ra1 G T 4: 135,748,160 C247F probably benign Het
Ivl T C 3: 92,572,584 E58G unknown Het
Kcnk9 G T 15: 72,546,099 Q61K probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Loxhd1 G T 18: 77,402,502 A1314S probably damaging Het
Lrba A G 3: 86,351,868 I1397V probably benign Het
Lrig3 T A 10: 125,997,051 probably null Het
Lrrc36 A G 8: 105,449,765 D378G probably damaging Het
Lrrc49 G A 9: 60,598,191 T527I probably damaging Het
Map4k4 C A 1: 40,023,460 T1195K probably damaging Het
Mrps33 G A 6: 39,802,495 R89C probably damaging Het
Mtor T C 4: 148,462,892 V444A probably benign Het
Myh2 A G 11: 67,188,938 E1046G probably damaging Het
Myo15b G T 11: 115,880,509 probably null Het
Myo5c T C 9: 75,246,164 Y111H probably damaging Het
Ndufv2 G C 17: 66,083,486 T163R probably damaging Het
Nf1 A G 11: 79,553,968 N373S possibly damaging Het
Nwd2 A G 5: 63,805,574 M834V probably benign Het
Ogfod2 T C 5: 124,114,956 V343A probably damaging Het
Olfr1220 T A 2: 89,097,706 T74S probably benign Het
Olfr401 A T 11: 74,121,408 T40S probably benign Het
Olfr597 T A 7: 103,320,414 M1K probably null Het
Olfr610 T C 7: 103,506,041 I302V possibly damaging Het
Olfr736 C A 14: 50,393,329 S191* probably null Het
Olfr744 C T 14: 50,618,686 L155F probably benign Het
Olfr954 A T 9: 39,462,114 I228F probably damaging Het
Parp1 T A 1: 180,600,526 probably null Het
Ppp3ca A T 3: 136,935,031 I448F probably damaging Het
Prss44 T C 9: 110,817,204 V333A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rars A C 11: 35,825,995 D231E probably benign Het
Rfc1 T C 5: 65,264,379 Y1059C probably damaging Het
Rilpl1 T A 5: 124,514,656 I2F probably damaging Het
Sarm1 G T 11: 78,490,994 A221E possibly damaging Het
Serpina3f A G 12: 104,217,406 T176A probably damaging Het
Slc22a20 T C 19: 5,985,667 E131G probably benign Het
Slc26a11 T C 11: 119,373,153 V343A probably damaging Het
Slc2a4 A G 11: 69,946,307 I9T probably benign Het
Slc39a6 G T 18: 24,585,202 D599E probably damaging Het
Slc5a6 G T 5: 31,040,676 S285* probably null Het
Spata9 A G 13: 75,977,641 H81R probably benign Het
St7l A G 3: 104,919,496 E436G probably damaging Het
Tecrl A G 5: 83,279,230 I357T probably damaging Het
Thop1 C T 10: 81,073,209 R25C probably damaging Het
Tmprss12 A G 15: 100,292,547 E266G probably benign Het
Tpgs1 T A 10: 79,675,510 V162D possibly damaging Het
Trpa1 C T 1: 14,874,424 R1032Q probably benign Het
Tspan12 A G 6: 21,795,700 Y164H probably damaging Het
Ubr4 T C 4: 139,407,963 Y869H probably damaging Het
Vmn1r21 A G 6: 57,843,814 I215T probably benign Het
Zan A T 5: 137,386,451 S5104T unknown Het
Zfp318 T C 17: 46,412,054 V1661A probably benign Het
Zfp365 C T 10: 67,888,942 R372K probably damaging Het
Other mutations in Dab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Dab2 APN 15 6429825 missense probably benign 0.00
IGL00731:Dab2 APN 15 6435710 missense possibly damaging 0.95
IGL02382:Dab2 APN 15 6436987 missense possibly damaging 0.62
IGL02598:Dab2 APN 15 6429366 missense probably damaging 0.97
IGL03054:Dab2 APN 15 6418226 unclassified probably benign
IGL03093:Dab2 APN 15 6436411 missense probably damaging 1.00
IGL03369:Dab2 APN 15 6435309 missense possibly damaging 0.64
IGL03372:Dab2 APN 15 6429549 missense probably damaging 0.99
R0157:Dab2 UTSW 15 6429827 missense probably benign 0.00
R0326:Dab2 UTSW 15 6418316 missense probably damaging 1.00
R0488:Dab2 UTSW 15 6424654 missense probably damaging 1.00
R0552:Dab2 UTSW 15 6435414 missense possibly damaging 0.65
R0938:Dab2 UTSW 15 6435384 missense probably benign 0.04
R1433:Dab2 UTSW 15 6429938 missense probably damaging 1.00
R1635:Dab2 UTSW 15 6429870 missense possibly damaging 0.80
R1713:Dab2 UTSW 15 6429701 missense possibly damaging 0.94
R1757:Dab2 UTSW 15 6330452 intron probably benign
R1837:Dab2 UTSW 15 6336476 intron probably benign
R1999:Dab2 UTSW 15 6416917 missense probably benign 0.32
R2050:Dab2 UTSW 15 6435215 missense possibly damaging 0.47
R2117:Dab2 UTSW 15 6435615 missense probably damaging 1.00
R2129:Dab2 UTSW 15 6336383 nonsense probably null
R2150:Dab2 UTSW 15 6416917 missense probably benign 0.32
R2329:Dab2 UTSW 15 6429563 missense possibly damaging 0.80
R2338:Dab2 UTSW 15 6435252 missense possibly damaging 0.62
R2680:Dab2 UTSW 15 6436993 missense possibly damaging 0.89
R3978:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R3979:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R3980:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R4551:Dab2 UTSW 15 6435294 missense probably damaging 0.97
R4795:Dab2 UTSW 15 6429611 missense probably benign 0.16
R4829:Dab2 UTSW 15 6424681 missense probably damaging 1.00
R4830:Dab2 UTSW 15 6427527 missense probably benign
R4832:Dab2 UTSW 15 6336599 splice site probably null
R5168:Dab2 UTSW 15 6336443 intron probably benign
R5620:Dab2 UTSW 15 6418315 missense probably damaging 0.98
R5996:Dab2 UTSW 15 6435311 nonsense probably null
R6159:Dab2 UTSW 15 6436460 missense possibly damaging 0.93
R6998:Dab2 UTSW 15 6424649 missense possibly damaging 0.49
R7002:Dab2 UTSW 15 6435365 missense probably benign 0.01
R7040:Dab2 UTSW 15 6422251 missense probably damaging 1.00
R7138:Dab2 UTSW 15 6429299 missense probably benign 0.24
R7448:Dab2 UTSW 15 6422266 missense probably damaging 1.00
R7548:Dab2 UTSW 15 6429918 missense possibly damaging 0.80
R8062:Dab2 UTSW 15 6427341 missense probably damaging 0.99
R8124:Dab2 UTSW 15 6429397 nonsense probably null
R8164:Dab2 UTSW 15 6430968 missense possibly damaging 0.92
R8171:Dab2 UTSW 15 6423926 missense probably benign 0.00
R8230:Dab2 UTSW 15 6422343 missense probably damaging 1.00
R8372:Dab2 UTSW 15 6416925 missense possibly damaging 0.80
R8427:Dab2 UTSW 15 6429359 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCATAATAAGTGGCCAGCCTC -3'
(R):5'- CGCAGCTGGAAGTCCTTAAAC -3'

Sequencing Primer
(F):5'- GGCCAGCCACTCGTTTTTGG -3'
(R):5'- CGCAGCTGGAAGTCCTTAAACATTTC -3'
Posted On2014-06-23