Incidental Mutation 'R1800:Zfp318'
ID203093
Institutional Source Beutler Lab
Gene Symbol Zfp318
Ensembl Gene ENSMUSG00000015597
Gene Namezinc finger protein 318
Synonyms2610034E08Rik, D530032D06Rik, TZF
MMRRC Submission 039830-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1800 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46383731-46420920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46412054 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1661 (V1661A)
Ref Sequence ENSEMBL: ENSMUSP00000109109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113481] [ENSMUST00000138127] [ENSMUST00000152472]
Predicted Effect probably benign
Transcript: ENSMUST00000113481
AA Change: V1661A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109109
Gene: ENSMUSG00000015597
AA Change: V1661A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
SCOP:d1eq1a_ 916 995 2e-4 SMART
low complexity region 1018 1055 N/A INTRINSIC
ZnF_U1 1085 1119 5.99e-7 SMART
ZnF_C2H2 1088 1112 4.5e1 SMART
ZnF_U1 1155 1189 2.1e-11 SMART
ZnF_C2H2 1158 1180 4.62e1 SMART
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1358 1371 N/A INTRINSIC
low complexity region 1640 1651 N/A INTRINSIC
Blast:HNHc 1660 1710 3e-17 BLAST
low complexity region 2001 2013 N/A INTRINSIC
low complexity region 2110 2121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136017
Predicted Effect probably benign
Transcript: ENSMUST00000138127
SMART Domains Protein: ENSMUSP00000116544
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
Blast:HOLI 854 1114 8e-19 BLAST
SCOP:d1eq1a_ 916 995 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152472
SMART Domains Protein: ENSMUSP00000116132
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
coiled coil region 3 30 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced male fertility and altered IgM and IgD levels. Null mutants displayed normal level of circulating B cells with decreased IgD and increased IgM levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,718 K556R probably damaging Het
4933406P04Rik A T 10: 20,311,147 probably benign Het
A530099J19Rik T C 13: 19,729,679 noncoding transcript Het
Acmsd C A 1: 127,759,756 Y258* probably null Het
Adgrf5 A T 17: 43,451,082 I1223F probably damaging Het
Afp C T 5: 90,490,796 P6S probably benign Het
Agap2 C A 10: 127,091,671 H1120Q probably damaging Het
Angpt1 A G 15: 42,512,404 V152A probably damaging Het
Ankrd1 A T 19: 36,119,359 F23I probably damaging Het
Armc12 T C 17: 28,538,895 S334P possibly damaging Het
Arnt2 C A 7: 84,275,375 D415Y probably damaging Het
Cacna1s G T 1: 136,076,854 V131L probably benign Het
Cacna2d2 T C 9: 107,527,433 V1141A possibly damaging Het
Cfap61 T C 2: 146,042,622 L580P probably damaging Het
Chga A T 12: 102,555,905 S23C probably damaging Het
Chrna5 A G 9: 55,004,875 T320A probably damaging Het
Col17a1 G T 19: 47,650,862 N1081K possibly damaging Het
Cox7b2 A T 5: 71,443,063 C51S possibly damaging Het
Cwc22 A T 2: 77,929,453 D83E possibly damaging Het
D130043K22Rik A C 13: 24,883,894 D871A probably damaging Het
Dab2 A T 15: 6,435,467 M361L probably benign Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnmbp A G 19: 43,901,720 I536T probably benign Het
Ehmt1 A T 2: 24,884,290 S43R probably damaging Het
Ercc5 T C 1: 44,173,380 L666P probably benign Het
F5 A G 1: 164,182,834 H378R probably damaging Het
Fam84a T C 12: 14,150,225 Y167C probably damaging Het
Fat2 A T 11: 55,283,892 N1998K probably damaging Het
Fbxo28 T C 1: 182,341,534 D13G unknown Het
Fras1 T C 5: 96,709,882 S2012P probably benign Het
Gm4758 T A 16: 36,312,533 D57E probably damaging Het
Gm5624 T A 14: 44,561,845 N41I probably damaging Het
Gm6768 A T 12: 119,261,771 noncoding transcript Het
Gm8104 A G 14: 43,101,571 I73V possibly damaging Het
Gpr68 G A 12: 100,878,908 P126S probably damaging Het
Gucy1a2 A T 9: 3,582,685 T156S possibly damaging Het
Hacl1 T A 14: 31,614,264 Y429F probably damaging Het
Haus3 A C 5: 34,163,572 L510R probably damaging Het
Helq C T 5: 100,774,124 G738D probably benign Het
Hsd3b2 G C 3: 98,712,237 P131A probably damaging Het
Il22ra1 G T 4: 135,748,160 C247F probably benign Het
Ivl T C 3: 92,572,584 E58G unknown Het
Kcnk9 G T 15: 72,546,099 Q61K probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Loxhd1 G T 18: 77,402,502 A1314S probably damaging Het
Lrba A G 3: 86,351,868 I1397V probably benign Het
Lrig3 T A 10: 125,997,051 probably null Het
Lrrc36 A G 8: 105,449,765 D378G probably damaging Het
Lrrc49 G A 9: 60,598,191 T527I probably damaging Het
Map4k4 C A 1: 40,023,460 T1195K probably damaging Het
Mrps33 G A 6: 39,802,495 R89C probably damaging Het
Mtor T C 4: 148,462,892 V444A probably benign Het
Myh2 A G 11: 67,188,938 E1046G probably damaging Het
Myo15b G T 11: 115,880,509 probably null Het
Myo5c T C 9: 75,246,164 Y111H probably damaging Het
Ndufv2 G C 17: 66,083,486 T163R probably damaging Het
Nf1 A G 11: 79,553,968 N373S possibly damaging Het
Nwd2 A G 5: 63,805,574 M834V probably benign Het
Ogfod2 T C 5: 124,114,956 V343A probably damaging Het
Olfr1220 T A 2: 89,097,706 T74S probably benign Het
Olfr401 A T 11: 74,121,408 T40S probably benign Het
Olfr597 T A 7: 103,320,414 M1K probably null Het
Olfr610 T C 7: 103,506,041 I302V possibly damaging Het
Olfr736 C A 14: 50,393,329 S191* probably null Het
Olfr744 C T 14: 50,618,686 L155F probably benign Het
Olfr954 A T 9: 39,462,114 I228F probably damaging Het
Parp1 T A 1: 180,600,526 probably null Het
Ppp3ca A T 3: 136,935,031 I448F probably damaging Het
Prss44 T C 9: 110,817,204 V333A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rars A C 11: 35,825,995 D231E probably benign Het
Rfc1 T C 5: 65,264,379 Y1059C probably damaging Het
Rilpl1 T A 5: 124,514,656 I2F probably damaging Het
Sarm1 G T 11: 78,490,994 A221E possibly damaging Het
Serpina3f A G 12: 104,217,406 T176A probably damaging Het
Slc22a20 T C 19: 5,985,667 E131G probably benign Het
Slc26a11 T C 11: 119,373,153 V343A probably damaging Het
Slc2a4 A G 11: 69,946,307 I9T probably benign Het
Slc39a6 G T 18: 24,585,202 D599E probably damaging Het
Slc5a6 G T 5: 31,040,676 S285* probably null Het
Spata9 A G 13: 75,977,641 H81R probably benign Het
St7l A G 3: 104,919,496 E436G probably damaging Het
Tecrl A G 5: 83,279,230 I357T probably damaging Het
Thop1 C T 10: 81,073,209 R25C probably damaging Het
Tmprss12 A G 15: 100,292,547 E266G probably benign Het
Tpgs1 T A 10: 79,675,510 V162D possibly damaging Het
Trpa1 C T 1: 14,874,424 R1032Q probably benign Het
Tspan12 A G 6: 21,795,700 Y164H probably damaging Het
Ubr4 T C 4: 139,407,963 Y869H probably damaging Het
Vmn1r21 A G 6: 57,843,814 I215T probably benign Het
Zan A T 5: 137,386,451 S5104T unknown Het
Zfp365 C T 10: 67,888,942 R372K probably damaging Het
Other mutations in Zfp318
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Zfp318 APN 17 46412472 missense probably benign 0.01
IGL00978:Zfp318 APN 17 46413726 missense possibly damaging 0.64
IGL01016:Zfp318 APN 17 46400077 missense probably damaging 1.00
IGL01310:Zfp318 APN 17 46413227 missense possibly damaging 0.81
IGL01453:Zfp318 APN 17 46409016 splice site probably null
IGL01887:Zfp318 APN 17 46399168 missense probably benign 0.07
IGL02025:Zfp318 APN 17 46396810 nonsense probably null
IGL02026:Zfp318 APN 17 46396810 nonsense probably null
IGL02070:Zfp318 APN 17 46396718 missense probably damaging 1.00
IGL02182:Zfp318 APN 17 46396810 nonsense probably null
IGL02187:Zfp318 APN 17 46396810 nonsense probably null
IGL02188:Zfp318 APN 17 46396810 nonsense probably null
IGL02189:Zfp318 APN 17 46396810 nonsense probably null
IGL02190:Zfp318 APN 17 46396810 nonsense probably null
IGL02191:Zfp318 APN 17 46396810 nonsense probably null
IGL02192:Zfp318 APN 17 46396810 nonsense probably null
IGL02203:Zfp318 APN 17 46396810 nonsense probably null
IGL02224:Zfp318 APN 17 46396810 nonsense probably null
IGL02230:Zfp318 APN 17 46396810 nonsense probably null
IGL02231:Zfp318 APN 17 46396810 nonsense probably null
IGL02232:Zfp318 APN 17 46396810 nonsense probably null
IGL02233:Zfp318 APN 17 46396810 nonsense probably null
IGL02234:Zfp318 APN 17 46396810 nonsense probably null
IGL02412:Zfp318 APN 17 46409117 nonsense probably null
IGL02792:Zfp318 APN 17 46409178 missense probably damaging 1.00
IGL02826:Zfp318 APN 17 46398754 missense probably damaging 1.00
Wonton UTSW 17 46409692 missense possibly damaging 0.89
I0000:Zfp318 UTSW 17 46399559 missense probably damaging 1.00
R0206:Zfp318 UTSW 17 46399019 missense probably benign 0.07
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0281:Zfp318 UTSW 17 46412614 missense probably benign 0.05
R0350:Zfp318 UTSW 17 46413198 missense probably benign 0.00
R0383:Zfp318 UTSW 17 46413296 missense probably damaging 0.99
R0453:Zfp318 UTSW 17 46396708 missense probably damaging 0.96
R1014:Zfp318 UTSW 17 46412536 nonsense probably null
R1166:Zfp318 UTSW 17 46409692 missense possibly damaging 0.89
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1327:Zfp318 UTSW 17 46413263 missense probably damaging 1.00
R1330:Zfp318 UTSW 17 46413758 missense possibly damaging 0.90
R1737:Zfp318 UTSW 17 46399477 missense probably benign 0.35
R1846:Zfp318 UTSW 17 46413666 missense probably benign 0.00
R1848:Zfp318 UTSW 17 46406055 missense possibly damaging 0.92
R1861:Zfp318 UTSW 17 46411440 missense possibly damaging 0.92
R1913:Zfp318 UTSW 17 46412524 unclassified probably benign
R1913:Zfp318 UTSW 17 46412514 unclassified probably benign
R2059:Zfp318 UTSW 17 46397024 missense probably damaging 0.99
R2085:Zfp318 UTSW 17 46409664 splice site probably null
R2122:Zfp318 UTSW 17 46413371 missense probably benign 0.01
R2339:Zfp318 UTSW 17 46399463 missense probably benign 0.01
R4526:Zfp318 UTSW 17 46412358 missense probably benign 0.00
R4564:Zfp318 UTSW 17 46412815 missense possibly damaging 0.77
R4689:Zfp318 UTSW 17 46399634 missense probably damaging 0.99
R4795:Zfp318 UTSW 17 46412062 missense probably benign 0.07
R5256:Zfp318 UTSW 17 46412069 missense probably benign 0.19
R5317:Zfp318 UTSW 17 46412537 unclassified probably benign
R5323:Zfp318 UTSW 17 46386736 missense probably damaging 0.99
R5436:Zfp318 UTSW 17 46413049 missense possibly damaging 0.95
R5485:Zfp318 UTSW 17 46412254 missense possibly damaging 0.81
R5627:Zfp318 UTSW 17 46413136 missense probably damaging 1.00
R5643:Zfp318 UTSW 17 46409244 intron probably benign
R5782:Zfp318 UTSW 17 46412514 unclassified probably benign
R5783:Zfp318 UTSW 17 46412514 unclassified probably benign
R5820:Zfp318 UTSW 17 46412773 missense probably benign
R5895:Zfp318 UTSW 17 46399033 missense probably damaging 1.00
R6189:Zfp318 UTSW 17 46412514 unclassified probably benign
R6385:Zfp318 UTSW 17 46411006 missense probably damaging 1.00
R6428:Zfp318 UTSW 17 46399336 missense probably damaging 1.00
R6471:Zfp318 UTSW 17 46399505 missense probably benign 0.05
R6666:Zfp318 UTSW 17 46409214 missense probably benign 0.01
R6812:Zfp318 UTSW 17 46412542 unclassified probably benign
R6852:Zfp318 UTSW 17 46412533 unclassified probably benign
R6852:Zfp318 UTSW 17 46412534 unclassified probably benign
R6852:Zfp318 UTSW 17 46412538 unclassified probably benign
R6854:Zfp318 UTSW 17 46412542 unclassified probably benign
R6980:Zfp318 UTSW 17 46397212 missense probably damaging 1.00
R6999:Zfp318 UTSW 17 46400043 missense probably damaging 1.00
R7164:Zfp318 UTSW 17 46397306 critical splice donor site probably null
R7164:Zfp318 UTSW 17 46405939 missense probably damaging 1.00
R7175:Zfp318 UTSW 17 46386848 missense probably damaging 1.00
R7233:Zfp318 UTSW 17 46406052 missense probably damaging 0.99
R7339:Zfp318 UTSW 17 46411247 missense probably damaging 0.99
R7426:Zfp318 UTSW 17 46400069 missense probably damaging 1.00
R7600:Zfp318 UTSW 17 46384284 missense possibly damaging 0.86
R7608:Zfp318 UTSW 17 46400009 missense probably damaging 0.96
R7779:Zfp318 UTSW 17 46399894 missense probably benign 0.16
R8057:Zfp318 UTSW 17 46399766 missense possibly damaging 0.72
R8273:Zfp318 UTSW 17 46412375 missense probably damaging 1.00
R8274:Zfp318 UTSW 17 46412989 missense probably benign
X0026:Zfp318 UTSW 17 46410638 missense possibly damaging 0.89
X0054:Zfp318 UTSW 17 46412609 missense possibly damaging 0.79
X0065:Zfp318 UTSW 17 46410989 missense probably benign 0.01
Z1176:Zfp318 UTSW 17 46405978 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATTCGTGCTTAGCCACAGCC -3'
(R):5'- CAAAGTGTCTGTCTTTGGGGAAAC -3'

Sequencing Primer
(F):5'- GCCAATGCTAAGGACCTGTATG -3'
(R):5'- CTTTGGGGAAACTATTTCATAAGGC -3'
Posted On2014-06-23