Incidental Mutation 'R1801:Olfr1197'
ID203107
Institutional Source Beutler Lab
Gene Symbol Olfr1197
Ensembl Gene ENSMUSG00000075119
Gene Nameolfactory receptor 1197
SynonymsMOR225-10P, GA_x6K02T2Q125-50202854-50201910, MOR225-14
MMRRC Submission 039831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1801 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88726903-88732366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88729264 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 112 (I112F)
Ref Sequence ENSEMBL: ENSMUSP00000150290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099815] [ENSMUST00000213118]
Predicted Effect probably damaging
Transcript: ENSMUST00000099815
AA Change: I112F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097403
Gene: ENSMUSG00000075119
AA Change: I112F

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 1.3e-45 PFAM
Pfam:7tm_1 39 285 7.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213118
AA Change: I112F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,396 E362G probably damaging Het
Abcc5 T C 16: 20,338,887 M1307V probably benign Het
Adamts9 A G 6: 92,863,376 V1142A probably benign Het
Ano10 T C 9: 122,253,030 N525S probably damaging Het
Bpifa2 T C 2: 154,011,504 probably null Het
C7 C T 15: 5,012,021 V468I possibly damaging Het
Carf A T 1: 60,141,505 H362L possibly damaging Het
Ccdc171 A C 4: 83,546,895 I37L probably benign Het
Ccdc182 T C 11: 88,294,190 L32P possibly damaging Het
Celsr3 A T 9: 108,834,626 D1678V possibly damaging Het
Col7a1 A T 9: 108,960,997 Y920F unknown Het
Cpsf3 T C 12: 21,313,790 V627A probably benign Het
D7Ertd443e A G 7: 134,270,212 M640T probably damaging Het
Ddi2 T C 4: 141,683,972 D543G probably damaging Het
Dnah9 T C 11: 65,955,297 N2972D probably damaging Het
Dnajc18 T C 18: 35,680,804 D304G probably damaging Het
Epg5 T C 18: 77,983,490 V1232A possibly damaging Het
Ezr T C 17: 6,742,372 T358A possibly damaging Het
Filip1 A G 9: 79,815,846 S1164P probably damaging Het
Gm14085 C T 2: 122,521,652 R324C possibly damaging Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gmip T C 8: 69,814,477 V341A probably benign Het
Gnb3 A C 6: 124,835,636 F286V probably benign Het
Gpatch2 T A 1: 187,225,831 S128T probably benign Het
Gpr87 T C 3: 59,179,392 R231G possibly damaging Het
Hip1r G A 5: 123,998,808 R613Q probably benign Het
Hsd3b7 T C 7: 127,803,034 Y284H possibly damaging Het
Il1rap A T 16: 26,698,875 D275V probably damaging Het
Il4 G T 11: 53,618,538 H23Q possibly damaging Het
Kit A G 5: 75,648,393 Y749C probably damaging Het
Klb A G 5: 65,349,235 K275R probably null Het
Klhl12 G T 1: 134,489,070 R510L probably damaging Het
Lrrc8b A G 5: 105,480,823 Y345C probably damaging Het
Med15 T C 16: 17,680,735 T98A possibly damaging Het
Mmp1a T A 9: 7,475,390 Y387N probably damaging Het
Myrf C A 19: 10,214,191 V928L probably benign Het
Nr1d1 T C 11: 98,771,499 K134E probably damaging Het
Nrxn3 A T 12: 90,283,582 D305V probably damaging Het
Obscn A C 11: 58,998,321 S7542A unknown Het
Pak4 G A 7: 28,565,190 R96C probably damaging Het
Papd5 T G 8: 88,250,788 V406G probably benign Het
Pde6b A T 5: 108,427,847 D691V possibly damaging Het
Pdss2 A G 10: 43,345,605 E171G probably benign Het
Pdzd2 C T 15: 12,387,654 V873I possibly damaging Het
Plb1 A T 5: 32,293,243 D376V probably damaging Het
Plekhg1 T C 10: 3,963,904 Y1209H probably damaging Het
Prickle2 A G 6: 92,416,904 C263R probably damaging Het
Psma2 A T 13: 14,623,605 Y104F probably benign Het
Ptger4 T A 15: 5,242,800 M113L possibly damaging Het
Rgs10 T G 7: 128,404,477 D17A possibly damaging Het
Rpap3 A G 15: 97,694,209 S189P possibly damaging Het
Rsbn1 T C 3: 103,914,872 L102P probably damaging Het
Ryr2 T C 13: 11,595,281 S655G probably benign Het
Samd4b A T 7: 28,407,331 probably null Het
Sema4a C T 3: 88,436,749 D732N probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Sh3gl3 C T 7: 82,284,119 T230I possibly damaging Het
Slc5a1 A T 5: 33,146,953 Q299L probably damaging Het
Ssc5d C A 7: 4,936,607 H681N probably benign Het
Sugp2 T C 8: 70,236,710 S10P possibly damaging Het
Supt5 A G 7: 28,317,214 probably null Het
Syna A G 5: 134,560,089 V2A probably benign Het
Tcp1 T A 17: 12,922,202 Y299* probably null Het
Tenm3 C A 8: 48,276,256 V1572L probably benign Het
Trp53rka A G 2: 165,491,613 S119P probably damaging Het
Ubr4 T A 4: 139,452,563 probably null Het
Uchl4 T A 9: 64,235,475 D79E probably benign Het
Vmn2r17 C A 5: 109,428,478 T405K probably damaging Het
Xpnpep1 A G 19: 53,010,133 L228P probably damaging Het
Xrcc4 T G 13: 89,992,579 E170D probably damaging Het
Zfp945 T C 17: 22,851,762 T388A probably damaging Het
Zfp947 G A 17: 22,146,462 A77V probably benign Het
Zkscan5 G A 5: 145,220,205 G433R probably damaging Het
Other mutations in Olfr1197
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1197 APN 2 88729065 missense probably damaging 1.00
IGL01515:Olfr1197 APN 2 88729008 missense probably benign
IGL01822:Olfr1197 APN 2 88728792 missense probably benign 0.03
IGL02060:Olfr1197 APN 2 88729563 missense probably damaging 0.98
IGL02466:Olfr1197 APN 2 88729395 missense probably damaging 1.00
IGL02698:Olfr1197 APN 2 88729471 missense probably damaging 1.00
R0336:Olfr1197 UTSW 2 88729154 missense possibly damaging 0.47
R1037:Olfr1197 UTSW 2 88729032 missense probably damaging 1.00
R1120:Olfr1197 UTSW 2 88728937 missense probably damaging 1.00
R1674:Olfr1197 UTSW 2 88729257 missense probably damaging 0.99
R1860:Olfr1197 UTSW 2 88729330 missense probably damaging 1.00
R1861:Olfr1197 UTSW 2 88729330 missense probably damaging 1.00
R2049:Olfr1197 UTSW 2 88728745 missense probably damaging 1.00
R2308:Olfr1197 UTSW 2 88729084 missense probably damaging 0.97
R2411:Olfr1197 UTSW 2 88729397 missense probably benign 0.06
R4707:Olfr1197 UTSW 2 88728712 missense possibly damaging 0.62
R5000:Olfr1197 UTSW 2 88729566 missense probably damaging 0.96
R5157:Olfr1197 UTSW 2 88729548 missense probably benign
R6000:Olfr1197 UTSW 2 88729231 missense probably damaging 1.00
R6021:Olfr1197 UTSW 2 88728950 nonsense probably null
R6389:Olfr1197 UTSW 2 88728672 missense probably benign 0.00
R6636:Olfr1197 UTSW 2 88728841 missense probably benign 0.01
R6637:Olfr1197 UTSW 2 88728841 missense probably benign 0.01
R6979:Olfr1197 UTSW 2 88729184 missense probably benign 0.03
R7618:Olfr1197 UTSW 2 88728836 nonsense probably null
X0020:Olfr1197 UTSW 2 88729381 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTGATGTCACACAAGTAG -3'
(R):5'- AATGGGGAACTCCGTCATCC -3'

Sequencing Primer
(F):5'- ACAAGTAGTGATTGATGTGGTTG -3'
(R):5'- GGGGAACTCCGTCATCCTTCTC -3'
Posted On2014-06-23