Incidental Mutation 'R1801:Slc28a2b'
ID 203109
Institutional Source Beutler Lab
Gene Symbol Slc28a2b
Ensembl Gene ENSMUSG00000079071
Gene Name solute carrier family 28 member 2b
Synonyms Gm14085
MMRRC Submission 039831-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R1801 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 122315422-122358521 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 122352133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 324 (R324C)
Ref Sequence ENSEMBL: ENSMUSP00000106150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110521]
AlphaFold A2AWR5
Predicted Effect possibly damaging
Transcript: ENSMUST00000110521
AA Change: R324C

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071
AA Change: R324C

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 149 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 2.3e-28 PFAM
Pfam:Gate 260 360 1.7e-10 PFAM
Pfam:Nucleos_tra2_C 363 587 4.6e-70 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,903,230 (GRCm39) E362G probably damaging Het
Abcc5 T C 16: 20,157,637 (GRCm39) M1307V probably benign Het
Adam34l A T 8: 44,078,954 (GRCm39) C423* probably null Het
Adamts9 A G 6: 92,840,357 (GRCm39) V1142A probably benign Het
Ano10 T C 9: 122,082,096 (GRCm39) N525S probably damaging Het
Bpifa2 T C 2: 153,853,424 (GRCm39) probably null Het
C7 C T 15: 5,041,503 (GRCm39) V468I possibly damaging Het
Carf A T 1: 60,180,664 (GRCm39) H362L possibly damaging Het
Ccdc171 A C 4: 83,465,132 (GRCm39) I37L probably benign Het
Ccdc182 T C 11: 88,185,016 (GRCm39) L32P possibly damaging Het
Celsr3 A T 9: 108,711,825 (GRCm39) D1678V possibly damaging Het
Col7a1 A T 9: 108,790,065 (GRCm39) Y920F unknown Het
Cpsf3 T C 12: 21,363,791 (GRCm39) V627A probably benign Het
D7Ertd443e A G 7: 133,871,941 (GRCm39) M640T probably damaging Het
Ddi2 T C 4: 141,411,283 (GRCm39) D543G probably damaging Het
Dnah9 T C 11: 65,846,123 (GRCm39) N2972D probably damaging Het
Dnajc18 T C 18: 35,813,857 (GRCm39) D304G probably damaging Het
Epg5 T C 18: 78,026,705 (GRCm39) V1232A possibly damaging Het
Ezr T C 17: 7,009,771 (GRCm39) T358A possibly damaging Het
Filip1 A G 9: 79,723,128 (GRCm39) S1164P probably damaging Het
Gmip T C 8: 70,267,127 (GRCm39) V341A probably benign Het
Gnb3 A C 6: 124,812,599 (GRCm39) F286V probably benign Het
Gpatch2 T A 1: 186,958,028 (GRCm39) S128T probably benign Het
Gpr87 T C 3: 59,086,813 (GRCm39) R231G possibly damaging Het
Hip1r G A 5: 124,136,871 (GRCm39) R613Q probably benign Het
Hsd3b7 T C 7: 127,402,206 (GRCm39) Y284H possibly damaging Het
Il1rap A T 16: 26,517,625 (GRCm39) D275V probably damaging Het
Il4 G T 11: 53,509,365 (GRCm39) H23Q possibly damaging Het
Kit A G 5: 75,809,053 (GRCm39) Y749C probably damaging Het
Klb A G 5: 65,506,578 (GRCm39) K275R probably null Het
Klhl12 G T 1: 134,416,808 (GRCm39) R510L probably damaging Het
Lrrc8b A G 5: 105,628,689 (GRCm39) Y345C probably damaging Het
Med15 T C 16: 17,498,599 (GRCm39) T98A possibly damaging Het
Mmp1a T A 9: 7,475,391 (GRCm39) Y387N probably damaging Het
Myrf C A 19: 10,191,555 (GRCm39) V928L probably benign Het
Nr1d1 T C 11: 98,662,325 (GRCm39) K134E probably damaging Het
Nrxn3 A T 12: 90,250,356 (GRCm39) D305V probably damaging Het
Obscn A C 11: 58,889,147 (GRCm39) S7542A unknown Het
Or4a27 T A 2: 88,559,608 (GRCm39) I112F probably damaging Het
Pak4 G A 7: 28,264,615 (GRCm39) R96C probably damaging Het
Pde6b A T 5: 108,575,713 (GRCm39) D691V possibly damaging Het
Pdss2 A G 10: 43,221,601 (GRCm39) E171G probably benign Het
Pdzd2 C T 15: 12,387,740 (GRCm39) V873I possibly damaging Het
Plb1 A T 5: 32,450,587 (GRCm39) D376V probably damaging Het
Plekhg1 T C 10: 3,913,904 (GRCm39) Y1209H probably damaging Het
Prickle2 A G 6: 92,393,885 (GRCm39) C263R probably damaging Het
Psma2 A T 13: 14,798,190 (GRCm39) Y104F probably benign Het
Ptger4 T A 15: 5,272,281 (GRCm39) M113L possibly damaging Het
Rgs10 T G 7: 128,006,201 (GRCm39) D17A possibly damaging Het
Rpap3 A G 15: 97,592,090 (GRCm39) S189P possibly damaging Het
Rsbn1 T C 3: 103,822,188 (GRCm39) L102P probably damaging Het
Ryr2 T C 13: 11,610,167 (GRCm39) S655G probably benign Het
Samd4b A T 7: 28,106,756 (GRCm39) probably null Het
Sema4a C T 3: 88,344,056 (GRCm39) D732N probably benign Het
Sh3bp5l A G 11: 58,237,177 (GRCm39) D378G probably benign Het
Sh3gl3 C T 7: 81,933,327 (GRCm39) T230I possibly damaging Het
Slc5a1 A T 5: 33,304,297 (GRCm39) Q299L probably damaging Het
Ssc5d C A 7: 4,939,606 (GRCm39) H681N probably benign Het
Sugp2 T C 8: 70,689,360 (GRCm39) S10P possibly damaging Het
Supt5 A G 7: 28,016,639 (GRCm39) probably null Het
Syna A G 5: 134,588,943 (GRCm39) V2A probably benign Het
Tcp1 T A 17: 13,141,089 (GRCm39) Y299* probably null Het
Tenm3 C A 8: 48,729,291 (GRCm39) V1572L probably benign Het
Tent4b T G 8: 88,977,416 (GRCm39) V406G probably benign Het
Trp53rka A G 2: 165,333,533 (GRCm39) S119P probably damaging Het
Ubr4 T A 4: 139,179,874 (GRCm39) probably null Het
Uchl4 T A 9: 64,142,757 (GRCm39) D79E probably benign Het
Vmn2r17 C A 5: 109,576,344 (GRCm39) T405K probably damaging Het
Xpnpep1 A G 19: 52,998,564 (GRCm39) L228P probably damaging Het
Xrcc4 T G 13: 90,140,698 (GRCm39) E170D probably damaging Het
Zfp945 T C 17: 23,070,736 (GRCm39) T388A probably damaging Het
Zfp947 G A 17: 22,365,443 (GRCm39) A77V probably benign Het
Zkscan5 G A 5: 145,157,015 (GRCm39) G433R probably damaging Het
Other mutations in Slc28a2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Slc28a2b APN 2 122,347,527 (GRCm39) missense probably damaging 0.98
IGL01160:Slc28a2b APN 2 122,355,277 (GRCm39) critical splice acceptor site probably null
IGL01838:Slc28a2b APN 2 122,348,464 (GRCm39) missense possibly damaging 0.65
IGL01895:Slc28a2b APN 2 122,355,572 (GRCm39) missense possibly damaging 0.75
IGL02999:Slc28a2b APN 2 122,344,995 (GRCm39) splice site probably benign
Wilted UTSW 2 122,353,963 (GRCm39) missense probably damaging 1.00
K2124:Slc28a2b UTSW 2 122,355,634 (GRCm39) missense probably benign 0.00
R0084:Slc28a2b UTSW 2 122,353,314 (GRCm39) missense possibly damaging 0.95
R0092:Slc28a2b UTSW 2 122,348,078 (GRCm39) splice site probably benign
R0127:Slc28a2b UTSW 2 122,347,550 (GRCm39) critical splice donor site probably null
R0200:Slc28a2b UTSW 2 122,357,928 (GRCm39) makesense probably null
R0276:Slc28a2b UTSW 2 122,352,409 (GRCm39) missense probably damaging 1.00
R0309:Slc28a2b UTSW 2 122,348,034 (GRCm39) missense probably benign 0.04
R0403:Slc28a2b UTSW 2 122,352,335 (GRCm39) missense probably damaging 1.00
R0600:Slc28a2b UTSW 2 122,344,879 (GRCm39) missense probably damaging 0.97
R0612:Slc28a2b UTSW 2 122,352,179 (GRCm39) missense probably damaging 1.00
R1676:Slc28a2b UTSW 2 122,352,340 (GRCm39) missense probably damaging 0.99
R1986:Slc28a2b UTSW 2 122,357,910 (GRCm39) missense probably benign 0.00
R2050:Slc28a2b UTSW 2 122,353,349 (GRCm39) missense probably benign 0.21
R3078:Slc28a2b UTSW 2 122,344,895 (GRCm39) missense possibly damaging 0.63
R4075:Slc28a2b UTSW 2 122,344,892 (GRCm39) missense probably benign 0.00
R4096:Slc28a2b UTSW 2 122,353,209 (GRCm39) missense probably damaging 1.00
R4744:Slc28a2b UTSW 2 122,353,286 (GRCm39) nonsense probably null
R4796:Slc28a2b UTSW 2 122,344,940 (GRCm39) missense probably damaging 0.99
R5033:Slc28a2b UTSW 2 122,353,395 (GRCm39) critical splice donor site probably null
R5069:Slc28a2b UTSW 2 122,324,854 (GRCm39) missense possibly damaging 0.93
R5288:Slc28a2b UTSW 2 122,353,259 (GRCm39) missense probably benign 0.01
R5385:Slc28a2b UTSW 2 122,353,259 (GRCm39) missense probably benign 0.01
R5386:Slc28a2b UTSW 2 122,353,259 (GRCm39) missense probably benign 0.01
R5442:Slc28a2b UTSW 2 122,317,350 (GRCm39) missense probably benign
R5795:Slc28a2b UTSW 2 122,348,475 (GRCm39) missense possibly damaging 0.79
R6258:Slc28a2b UTSW 2 122,353,963 (GRCm39) missense probably damaging 1.00
R6260:Slc28a2b UTSW 2 122,353,963 (GRCm39) missense probably damaging 1.00
R6383:Slc28a2b UTSW 2 122,355,288 (GRCm39) missense probably benign 0.00
R7226:Slc28a2b UTSW 2 122,353,013 (GRCm39) missense probably benign 0.00
R7574:Slc28a2b UTSW 2 122,353,325 (GRCm39) missense not run
R7633:Slc28a2b UTSW 2 122,317,161 (GRCm39) missense probably null 0.05
R7705:Slc28a2b UTSW 2 122,352,110 (GRCm39) critical splice acceptor site probably null
R7726:Slc28a2b UTSW 2 122,317,214 (GRCm39) missense probably damaging 0.99
R7998:Slc28a2b UTSW 2 122,324,839 (GRCm39) missense probably damaging 0.97
R8269:Slc28a2b UTSW 2 122,352,169 (GRCm39) missense probably damaging 1.00
R8337:Slc28a2b UTSW 2 122,355,617 (GRCm39) missense probably benign 0.06
R8546:Slc28a2b UTSW 2 122,353,235 (GRCm39) missense probably benign 0.14
R8817:Slc28a2b UTSW 2 122,348,988 (GRCm39) missense possibly damaging 0.95
R8931:Slc28a2b UTSW 2 122,348,983 (GRCm39) missense
R9070:Slc28a2b UTSW 2 122,352,154 (GRCm39) missense probably damaging 1.00
R9542:Slc28a2b UTSW 2 122,324,822 (GRCm39) missense probably benign 0.26
R9702:Slc28a2b UTSW 2 122,354,012 (GRCm39) missense probably damaging 1.00
R9782:Slc28a2b UTSW 2 122,352,338 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTAAGTGCATGGATATAGGC -3'
(R):5'- AGCCAGATGGGGATTAGCAC -3'

Sequencing Primer
(F):5'- TGCATGGATATAGGCAGGGTAAAC -3'
(R):5'- CCACTATGGGGCTCAACATG -3'
Posted On 2014-06-23