Incidental Mutation 'R1801:Sema4a'
ID203113
Institutional Source Beutler Lab
Gene Symbol Sema4a
Ensembl Gene ENSMUSG00000028064
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A
SynonymsSemB, Semab, SemB
MMRRC Submission 039831-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R1801 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88435959-88461182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88436749 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 732 (D732N)
Ref Sequence ENSEMBL: ENSMUSP00000128887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029700] [ENSMUST00000107531] [ENSMUST00000165898] [ENSMUST00000166237] [ENSMUST00000169222]
Predicted Effect probably benign
Transcript: ENSMUST00000029700
AA Change: D732N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000029700
Gene: ENSMUSG00000028064
AA Change: D732N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107531
AA Change: D600N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103155
Gene: ENSMUSG00000028064
AA Change: D600N

DomainStartEndE-ValueType
Sema 2 346 2.06e-101 SMART
PSI 364 415 9.33e-13 SMART
transmembrane domain 548 570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156108
Predicted Effect probably benign
Transcript: ENSMUST00000165898
AA Change: D732N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128510
Gene: ENSMUSG00000028064
AA Change: D732N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166237
AA Change: D732N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125909
Gene: ENSMUSG00000028064
AA Change: D732N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169222
AA Change: D732N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128887
Gene: ENSMUSG00000028064
AA Change: D732N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183768
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of soluble and transmembrane proteins. Semaphorins are involved in numerous functions, including axon guidance, morphogenesis, carcinogenesis, and immunomodulation. The encoded protein is a single-pass type I membrane protein containing an immunoglobulin-like C2-type domain, a PSI domain and a sema domain. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. It is an activator of T-cell-mediated immunity and suppresses vascular endothelial growth factor (VEGF)-mediated endothelial cell migration and proliferation in vitro and angiogenesis in vivo. Mutations in this gene are associated with retinal degenerative diseases including retinitis pigmentosa type 35 (RP35) and cone-rod dystrophy type 10 (CORD10). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a knock-out allele show no obvious brain defects but exhibit impaired T cell priming and defective Th1 responses. Homozygotes for a gene trap allele show severe retinal degeneration with reduced retinal vessels, depigmentation and dysfunction of both rod and cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,396 E362G probably damaging Het
Abcc5 T C 16: 20,338,887 M1307V probably benign Het
Adamts9 A G 6: 92,863,376 V1142A probably benign Het
Ano10 T C 9: 122,253,030 N525S probably damaging Het
Bpifa2 T C 2: 154,011,504 probably null Het
C7 C T 15: 5,012,021 V468I possibly damaging Het
Carf A T 1: 60,141,505 H362L possibly damaging Het
Ccdc171 A C 4: 83,546,895 I37L probably benign Het
Ccdc182 T C 11: 88,294,190 L32P possibly damaging Het
Celsr3 A T 9: 108,834,626 D1678V possibly damaging Het
Col7a1 A T 9: 108,960,997 Y920F unknown Het
Cpsf3 T C 12: 21,313,790 V627A probably benign Het
D7Ertd443e A G 7: 134,270,212 M640T probably damaging Het
Ddi2 T C 4: 141,683,972 D543G probably damaging Het
Dnah9 T C 11: 65,955,297 N2972D probably damaging Het
Dnajc18 T C 18: 35,680,804 D304G probably damaging Het
Epg5 T C 18: 77,983,490 V1232A possibly damaging Het
Ezr T C 17: 6,742,372 T358A possibly damaging Het
Filip1 A G 9: 79,815,846 S1164P probably damaging Het
Gm14085 C T 2: 122,521,652 R324C possibly damaging Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gmip T C 8: 69,814,477 V341A probably benign Het
Gnb3 A C 6: 124,835,636 F286V probably benign Het
Gpatch2 T A 1: 187,225,831 S128T probably benign Het
Gpr87 T C 3: 59,179,392 R231G possibly damaging Het
Hip1r G A 5: 123,998,808 R613Q probably benign Het
Hsd3b7 T C 7: 127,803,034 Y284H possibly damaging Het
Il1rap A T 16: 26,698,875 D275V probably damaging Het
Il4 G T 11: 53,618,538 H23Q possibly damaging Het
Kit A G 5: 75,648,393 Y749C probably damaging Het
Klb A G 5: 65,349,235 K275R probably null Het
Klhl12 G T 1: 134,489,070 R510L probably damaging Het
Lrrc8b A G 5: 105,480,823 Y345C probably damaging Het
Med15 T C 16: 17,680,735 T98A possibly damaging Het
Mmp1a T A 9: 7,475,390 Y387N probably damaging Het
Myrf C A 19: 10,214,191 V928L probably benign Het
Nr1d1 T C 11: 98,771,499 K134E probably damaging Het
Nrxn3 A T 12: 90,283,582 D305V probably damaging Het
Obscn A C 11: 58,998,321 S7542A unknown Het
Olfr1197 T A 2: 88,729,264 I112F probably damaging Het
Pak4 G A 7: 28,565,190 R96C probably damaging Het
Papd5 T G 8: 88,250,788 V406G probably benign Het
Pde6b A T 5: 108,427,847 D691V possibly damaging Het
Pdss2 A G 10: 43,345,605 E171G probably benign Het
Pdzd2 C T 15: 12,387,654 V873I possibly damaging Het
Plb1 A T 5: 32,293,243 D376V probably damaging Het
Plekhg1 T C 10: 3,963,904 Y1209H probably damaging Het
Prickle2 A G 6: 92,416,904 C263R probably damaging Het
Psma2 A T 13: 14,623,605 Y104F probably benign Het
Ptger4 T A 15: 5,242,800 M113L possibly damaging Het
Rgs10 T G 7: 128,404,477 D17A possibly damaging Het
Rpap3 A G 15: 97,694,209 S189P possibly damaging Het
Rsbn1 T C 3: 103,914,872 L102P probably damaging Het
Ryr2 T C 13: 11,595,281 S655G probably benign Het
Samd4b A T 7: 28,407,331 probably null Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Sh3gl3 C T 7: 82,284,119 T230I possibly damaging Het
Slc5a1 A T 5: 33,146,953 Q299L probably damaging Het
Ssc5d C A 7: 4,936,607 H681N probably benign Het
Sugp2 T C 8: 70,236,710 S10P possibly damaging Het
Supt5 A G 7: 28,317,214 probably null Het
Syna A G 5: 134,560,089 V2A probably benign Het
Tcp1 T A 17: 12,922,202 Y299* probably null Het
Tenm3 C A 8: 48,276,256 V1572L probably benign Het
Trp53rka A G 2: 165,491,613 S119P probably damaging Het
Ubr4 T A 4: 139,452,563 probably null Het
Uchl4 T A 9: 64,235,475 D79E probably benign Het
Vmn2r17 C A 5: 109,428,478 T405K probably damaging Het
Xpnpep1 A G 19: 53,010,133 L228P probably damaging Het
Xrcc4 T G 13: 89,992,579 E170D probably damaging Het
Zfp945 T C 17: 22,851,762 T388A probably damaging Het
Zfp947 G A 17: 22,146,462 A77V probably benign Het
Zkscan5 G A 5: 145,220,205 G433R probably damaging Het
Other mutations in Sema4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Sema4a APN 3 88449810 missense probably damaging 1.00
IGL01722:Sema4a APN 3 88438184 missense probably benign 0.14
IGL01769:Sema4a APN 3 88449756 missense possibly damaging 0.86
IGL02076:Sema4a APN 3 88450522 missense probably damaging 0.99
IGL02202:Sema4a APN 3 88449743 missense probably damaging 1.00
R0145:Sema4a UTSW 3 88451422 missense probably damaging 1.00
R0386:Sema4a UTSW 3 88436800 missense possibly damaging 0.75
R0837:Sema4a UTSW 3 88453098 missense possibly damaging 0.46
R0863:Sema4a UTSW 3 88448149 unclassified probably benign
R1567:Sema4a UTSW 3 88452046 missense probably damaging 1.00
R1675:Sema4a UTSW 3 88454766 missense possibly damaging 0.66
R1739:Sema4a UTSW 3 88436838 missense possibly damaging 0.94
R1961:Sema4a UTSW 3 88438176 splice site probably benign
R2029:Sema4a UTSW 3 88451361 missense probably damaging 1.00
R4934:Sema4a UTSW 3 88438261 missense probably damaging 1.00
R5006:Sema4a UTSW 3 88436784 missense probably benign
R5309:Sema4a UTSW 3 88437036 missense probably damaging 1.00
R5312:Sema4a UTSW 3 88437036 missense probably damaging 1.00
R5338:Sema4a UTSW 3 88451497 missense probably benign 0.01
R5481:Sema4a UTSW 3 88453040 nonsense probably null
R5510:Sema4a UTSW 3 88449986 critical splice donor site probably null
R6046:Sema4a UTSW 3 88440701 missense probably damaging 1.00
R7242:Sema4a UTSW 3 88450109 missense probably damaging 1.00
Z1176:Sema4a UTSW 3 88437193 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACACACGTTAGCAGGAGAGC -3'
(R):5'- GTCTCCTATTGGGTAGACAGCC -3'

Sequencing Primer
(F):5'- CCTCCTACCCTGGTCAGAGTG -3'
(R):5'- GTAGACAGCCAGGACCAGC -3'
Posted On2014-06-23