Mutagenetix > Incidental Mutation

Incidental Mutation 'R1801:Sema4a'

203113

Institutional Source

Beutler Lab

Gene Symbol

Sema4a

Ensembl Gene

ENSMUSG00000028064

Gene Name

sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A

Synonyms

SemB, Semab, SemB

MMRRC Submission

039831-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R1801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88435959-88461182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 88436749 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 732 (D732N)

Ref Sequence

ENSEMBL: ENSMUSP00000128887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029700] [ENSMUST00000107531] [ENSMUST00000165898] [ENSMUST00000166237] [ENSMUST00000169222]

AlphaFold

Q62178

Predicted Effect

probably benign
Transcript: ENSMUST00000029700
AA Change: D732N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000029700
Gene: ENSMUSG00000028064
AA Change: D732N

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Sema	64	478	1.96e-166	SMART
PSI	496	547	9.33e-13	SMART
transmembrane domain	680	702	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107531
AA Change: D600N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000103155
Gene: ENSMUSG00000028064
AA Change: D600N

Domain	Start	End	E-Value	Type
Sema	2	346	2.06e-101	SMART
PSI	364	415	9.33e-13	SMART
transmembrane domain	548	570	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135539

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149145

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156108

Predicted Effect

probably benign
Transcript: ENSMUST00000165898
AA Change: D732N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000128510
Gene: ENSMUSG00000028064
AA Change: D732N

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Sema	64	478	1.96e-166	SMART
PSI	496	547	9.33e-13	SMART
transmembrane domain	680	702	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166237
AA Change: D732N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000125909
Gene: ENSMUSG00000028064
AA Change: D732N

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Sema	64	478	1.96e-166	SMART
PSI	496	547	9.33e-13	SMART
transmembrane domain	680	702	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169222
AA Change: D732N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000128887
Gene: ENSMUSG00000028064
AA Change: D732N

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Sema	64	478	1.96e-166	SMART
PSI	496	547	9.33e-13	SMART
transmembrane domain	680	702	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183768

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of soluble and transmembrane proteins. Semaphorins are involved in numerous functions, including axon guidance, morphogenesis, carcinogenesis, and immunomodulation. The encoded protein is a single-pass type I membrane protein containing an immunoglobulin-like C2-type domain, a PSI domain and a sema domain. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. It is an activator of T-cell-mediated immunity and suppresses vascular endothelial growth factor (VEGF)-mediated endothelial cell migration and proliferation in vitro and angiogenesis in vivo. Mutations in this gene are associated with retinal degenerative diseases including retinitis pigmentosa type 35 (RP35) and cone-rod dystrophy type 10 (CORD10). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a knock-out allele show no obvious brain defects but exhibit impaired T cell priming and defective Th1 responses. Homozygotes for a gene trap allele show severe retinal degeneration with reduced retinal vessels, depigmentation and dysfunction of both rod and cone photoreceptors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,067,396	E362G	probably damaging	Het
Abcc5	T	C	16: 20,338,887	M1307V	probably benign	Het
Adamts9	A	G	6: 92,863,376	V1142A	probably benign	Het
Ano10	T	C	9: 122,253,030	N525S	probably damaging	Het
Bpifa2	T	C	2: 154,011,504		probably null	Het
C7	C	T	15: 5,012,021	V468I	possibly damaging	Het
Carf	A	T	1: 60,141,505	H362L	possibly damaging	Het
Ccdc171	A	C	4: 83,546,895	I37L	probably benign	Het
Ccdc182	T	C	11: 88,294,190	L32P	possibly damaging	Het
Celsr3	A	T	9: 108,834,626	D1678V	possibly damaging	Het
Col7a1	A	T	9: 108,960,997	Y920F	unknown	Het
Cpsf3	T	C	12: 21,313,790	V627A	probably benign	Het
D7Ertd443e	A	G	7: 134,270,212	M640T	probably damaging	Het
Ddi2	T	C	4: 141,683,972	D543G	probably damaging	Het
Dnah9	T	C	11: 65,955,297	N2972D	probably damaging	Het
Dnajc18	T	C	18: 35,680,804	D304G	probably damaging	Het
Epg5	T	C	18: 77,983,490	V1232A	possibly damaging	Het
Ezr	T	C	17: 6,742,372	T358A	possibly damaging	Het
Filip1	A	G	9: 79,815,846	S1164P	probably damaging	Het
Gm14085	C	T	2: 122,521,652	R324C	possibly damaging	Het
Gm5346	A	T	8: 43,625,917	C423*	probably null	Het
Gmip	T	C	8: 69,814,477	V341A	probably benign	Het
Gnb3	A	C	6: 124,835,636	F286V	probably benign	Het
Gpatch2	T	A	1: 187,225,831	S128T	probably benign	Het
Gpr87	T	C	3: 59,179,392	R231G	possibly damaging	Het
Hip1r	G	A	5: 123,998,808	R613Q	probably benign	Het
Hsd3b7	T	C	7: 127,803,034	Y284H	possibly damaging	Het
Il1rap	A	T	16: 26,698,875	D275V	probably damaging	Het
Il4	G	T	11: 53,618,538	H23Q	possibly damaging	Het
Kit	A	G	5: 75,648,393	Y749C	probably damaging	Het
Klb	A	G	5: 65,349,235	K275R	probably null	Het
Klhl12	G	T	1: 134,489,070	R510L	probably damaging	Het
Lrrc8b	A	G	5: 105,480,823	Y345C	probably damaging	Het
Med15	T	C	16: 17,680,735	T98A	possibly damaging	Het
Mmp1a	T	A	9: 7,475,390	Y387N	probably damaging	Het
Myrf	C	A	19: 10,214,191	V928L	probably benign	Het
Nr1d1	T	C	11: 98,771,499	K134E	probably damaging	Het
Nrxn3	A	T	12: 90,283,582	D305V	probably damaging	Het
Obscn	A	C	11: 58,998,321	S7542A	unknown	Het
Olfr1197	T	A	2: 88,729,264	I112F	probably damaging	Het
Pak4	G	A	7: 28,565,190	R96C	probably damaging	Het
Papd5	T	G	8: 88,250,788	V406G	probably benign	Het
Pde6b	A	T	5: 108,427,847	D691V	possibly damaging	Het
Pdss2	A	G	10: 43,345,605	E171G	probably benign	Het
Pdzd2	C	T	15: 12,387,654	V873I	possibly damaging	Het
Plb1	A	T	5: 32,293,243	D376V	probably damaging	Het
Plekhg1	T	C	10: 3,963,904	Y1209H	probably damaging	Het
Prickle2	A	G	6: 92,416,904	C263R	probably damaging	Het
Psma2	A	T	13: 14,623,605	Y104F	probably benign	Het
Ptger4	T	A	15: 5,242,800	M113L	possibly damaging	Het
Rgs10	T	G	7: 128,404,477	D17A	possibly damaging	Het
Rpap3	A	G	15: 97,694,209	S189P	possibly damaging	Het
Rsbn1	T	C	3: 103,914,872	L102P	probably damaging	Het
Ryr2	T	C	13: 11,595,281	S655G	probably benign	Het
Samd4b	A	T	7: 28,407,331		probably null	Het
Sh3bp5l	A	G	11: 58,346,351	D378G	probably benign	Het
Sh3gl3	C	T	7: 82,284,119	T230I	possibly damaging	Het
Slc5a1	A	T	5: 33,146,953	Q299L	probably damaging	Het
Ssc5d	C	A	7: 4,936,607	H681N	probably benign	Het
Sugp2	T	C	8: 70,236,710	S10P	possibly damaging	Het
Supt5	A	G	7: 28,317,214		probably null	Het
Syna	A	G	5: 134,560,089	V2A	probably benign	Het
Tcp1	T	A	17: 12,922,202	Y299*	probably null	Het
Tenm3	C	A	8: 48,276,256	V1572L	probably benign	Het
Trp53rka	A	G	2: 165,491,613	S119P	probably damaging	Het
Ubr4	T	A	4: 139,452,563		probably null	Het
Uchl4	T	A	9: 64,235,475	D79E	probably benign	Het
Vmn2r17	C	A	5: 109,428,478	T405K	probably damaging	Het
Xpnpep1	A	G	19: 53,010,133	L228P	probably damaging	Het
Xrcc4	T	G	13: 89,992,579	E170D	probably damaging	Het
Zfp945	T	C	17: 22,851,762	T388A	probably damaging	Het
Zfp947	G	A	17: 22,146,462	A77V	probably benign	Het
Zkscan5	G	A	5: 145,220,205	G433R	probably damaging	Het

Other mutations in Sema4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00913:Sema4a	APN	3	88449810	missense	probably damaging	1.00
IGL01722:Sema4a	APN	3	88438184	missense	probably benign	0.14
IGL01769:Sema4a	APN	3	88449756	missense	possibly damaging	0.86
IGL02076:Sema4a	APN	3	88450522	missense	probably damaging	0.99
IGL02202:Sema4a	APN	3	88449743	missense	probably damaging	1.00
R0145:Sema4a	UTSW	3	88451422	missense	probably damaging	1.00
R0386:Sema4a	UTSW	3	88436800	missense	possibly damaging	0.75
R0837:Sema4a	UTSW	3	88453098	missense	possibly damaging	0.46
R0863:Sema4a	UTSW	3	88448149	unclassified	probably benign
R1567:Sema4a	UTSW	3	88452046	missense	probably damaging	1.00
R1675:Sema4a	UTSW	3	88454766	missense	possibly damaging	0.66
R1739:Sema4a	UTSW	3	88436838	missense	possibly damaging	0.94
R1961:Sema4a	UTSW	3	88438176	splice site	probably benign
R2029:Sema4a	UTSW	3	88451361	missense	probably damaging	1.00
R4934:Sema4a	UTSW	3	88438261	missense	probably damaging	1.00
R5006:Sema4a	UTSW	3	88436784	missense	probably benign
R5309:Sema4a	UTSW	3	88437036	missense	probably damaging	1.00
R5312:Sema4a	UTSW	3	88437036	missense	probably damaging	1.00
R5338:Sema4a	UTSW	3	88451497	missense	probably benign	0.01
R5481:Sema4a	UTSW	3	88453040	nonsense	probably null
R5510:Sema4a	UTSW	3	88449986	critical splice donor site	probably null
R6046:Sema4a	UTSW	3	88440701	missense	probably damaging	1.00
R7242:Sema4a	UTSW	3	88450109	missense	probably damaging	1.00
R8403:Sema4a	UTSW	3	88452034	missense	probably damaging	0.98
R8798:Sema4a	UTSW	3	88436697	missense	possibly damaging	0.76
R9328:Sema4a	UTSW	3	88438306	nonsense	probably null
R9638:Sema4a	UTSW	3	88449759	missense	probably damaging	1.00
R9728:Sema4a	UTSW	3	88440880	critical splice acceptor site	probably null
Z1176:Sema4a	UTSW	3	88437193	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ACACACGTTAGCAGGAGAGC -3'
(R):5'- GTCTCCTATTGGGTAGACAGCC -3'

Sequencing Primer
(F):5'- CCTCCTACCCTGGTCAGAGTG -3'
(R):5'- GTAGACAGCCAGGACCAGC -3'

Posted On

2014-06-23