Incidental Mutation 'R1801:Ccdc171'
ID203115
Institutional Source Beutler Lab
Gene Symbol Ccdc171
Ensembl Gene ENSMUSG00000052407
Gene Namecoiled-coil domain containing 171
Synonyms4930473A06Rik, 4930418J05Rik, A330015D16Rik
MMRRC Submission 039831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R1801 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location83525545-83864670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 83546895 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 37 (I37L)
Ref Sequence ENSEMBL: ENSMUSP00000116486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053414] [ENSMUST00000125077] [ENSMUST00000126429] [ENSMUST00000231339]
Predicted Effect probably benign
Transcript: ENSMUST00000053414
AA Change: I37L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000056520
Gene: ENSMUSG00000052407
AA Change: I37L

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 527 N/A INTRINSIC
coiled coil region 599 628 N/A INTRINSIC
coiled coil region 653 712 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 783 797 N/A INTRINSIC
coiled coil region 981 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107202
SMART Domains Protein: ENSMUSP00000102820
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 21 125 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125077
AA Change: I37L

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116486
Gene: ENSMUSG00000052407
AA Change: I37L

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 535 N/A INTRINSIC
coiled coil region 607 636 N/A INTRINSIC
coiled coil region 661 720 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
coiled coil region 989 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126429
AA Change: I37L

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138195
Gene: ENSMUSG00000052407
AA Change: I37L

DomainStartEndE-ValueType
coiled coil region 48 91 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231339
AA Change: I37L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that either homozygous or heterozygous for an ENU-induced single point mutation exhibit decreased mature B cell number, decreased IgD level, and increased IgM level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,396 E362G probably damaging Het
Abcc5 T C 16: 20,338,887 M1307V probably benign Het
Adamts9 A G 6: 92,863,376 V1142A probably benign Het
Ano10 T C 9: 122,253,030 N525S probably damaging Het
Bpifa2 T C 2: 154,011,504 probably null Het
C7 C T 15: 5,012,021 V468I possibly damaging Het
Carf A T 1: 60,141,505 H362L possibly damaging Het
Ccdc182 T C 11: 88,294,190 L32P possibly damaging Het
Celsr3 A T 9: 108,834,626 D1678V possibly damaging Het
Col7a1 A T 9: 108,960,997 Y920F unknown Het
Cpsf3 T C 12: 21,313,790 V627A probably benign Het
D7Ertd443e A G 7: 134,270,212 M640T probably damaging Het
Ddi2 T C 4: 141,683,972 D543G probably damaging Het
Dnah9 T C 11: 65,955,297 N2972D probably damaging Het
Dnajc18 T C 18: 35,680,804 D304G probably damaging Het
Epg5 T C 18: 77,983,490 V1232A possibly damaging Het
Ezr T C 17: 6,742,372 T358A possibly damaging Het
Filip1 A G 9: 79,815,846 S1164P probably damaging Het
Gm14085 C T 2: 122,521,652 R324C possibly damaging Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gmip T C 8: 69,814,477 V341A probably benign Het
Gnb3 A C 6: 124,835,636 F286V probably benign Het
Gpatch2 T A 1: 187,225,831 S128T probably benign Het
Gpr87 T C 3: 59,179,392 R231G possibly damaging Het
Hip1r G A 5: 123,998,808 R613Q probably benign Het
Hsd3b7 T C 7: 127,803,034 Y284H possibly damaging Het
Il1rap A T 16: 26,698,875 D275V probably damaging Het
Il4 G T 11: 53,618,538 H23Q possibly damaging Het
Kit A G 5: 75,648,393 Y749C probably damaging Het
Klb A G 5: 65,349,235 K275R probably null Het
Klhl12 G T 1: 134,489,070 R510L probably damaging Het
Lrrc8b A G 5: 105,480,823 Y345C probably damaging Het
Med15 T C 16: 17,680,735 T98A possibly damaging Het
Mmp1a T A 9: 7,475,390 Y387N probably damaging Het
Myrf C A 19: 10,214,191 V928L probably benign Het
Nr1d1 T C 11: 98,771,499 K134E probably damaging Het
Nrxn3 A T 12: 90,283,582 D305V probably damaging Het
Obscn A C 11: 58,998,321 S7542A unknown Het
Olfr1197 T A 2: 88,729,264 I112F probably damaging Het
Pak4 G A 7: 28,565,190 R96C probably damaging Het
Papd5 T G 8: 88,250,788 V406G probably benign Het
Pde6b A T 5: 108,427,847 D691V possibly damaging Het
Pdss2 A G 10: 43,345,605 E171G probably benign Het
Pdzd2 C T 15: 12,387,654 V873I possibly damaging Het
Plb1 A T 5: 32,293,243 D376V probably damaging Het
Plekhg1 T C 10: 3,963,904 Y1209H probably damaging Het
Prickle2 A G 6: 92,416,904 C263R probably damaging Het
Psma2 A T 13: 14,623,605 Y104F probably benign Het
Ptger4 T A 15: 5,242,800 M113L possibly damaging Het
Rgs10 T G 7: 128,404,477 D17A possibly damaging Het
Rpap3 A G 15: 97,694,209 S189P possibly damaging Het
Rsbn1 T C 3: 103,914,872 L102P probably damaging Het
Ryr2 T C 13: 11,595,281 S655G probably benign Het
Samd4b A T 7: 28,407,331 probably null Het
Sema4a C T 3: 88,436,749 D732N probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Sh3gl3 C T 7: 82,284,119 T230I possibly damaging Het
Slc5a1 A T 5: 33,146,953 Q299L probably damaging Het
Ssc5d C A 7: 4,936,607 H681N probably benign Het
Sugp2 T C 8: 70,236,710 S10P possibly damaging Het
Supt5 A G 7: 28,317,214 probably null Het
Syna A G 5: 134,560,089 V2A probably benign Het
Tcp1 T A 17: 12,922,202 Y299* probably null Het
Tenm3 C A 8: 48,276,256 V1572L probably benign Het
Trp53rka A G 2: 165,491,613 S119P probably damaging Het
Ubr4 T A 4: 139,452,563 probably null Het
Uchl4 T A 9: 64,235,475 D79E probably benign Het
Vmn2r17 C A 5: 109,428,478 T405K probably damaging Het
Xpnpep1 A G 19: 53,010,133 L228P probably damaging Het
Xrcc4 T G 13: 89,992,579 E170D probably damaging Het
Zfp945 T C 17: 22,851,762 T388A probably damaging Het
Zfp947 G A 17: 22,146,462 A77V probably benign Het
Zkscan5 G A 5: 145,220,205 G433R probably damaging Het
Other mutations in Ccdc171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Ccdc171 APN 4 83682324 nonsense probably null
IGL00707:Ccdc171 APN 4 83681155 missense probably benign 0.11
IGL00907:Ccdc171 APN 4 83864249 missense probably damaging 0.98
IGL01113:Ccdc171 APN 4 83661810 missense probably damaging 1.00
IGL01669:Ccdc171 APN 4 83681195 missense probably damaging 1.00
IGL01696:Ccdc171 APN 4 83655578 missense possibly damaging 0.66
IGL02006:Ccdc171 APN 4 83795242 missense possibly damaging 0.93
IGL02582:Ccdc171 APN 4 83743018 missense probably damaging 1.00
IGL03019:Ccdc171 APN 4 83795308 missense probably damaging 1.00
IGL03144:Ccdc171 APN 4 83818090 missense probably damaging 0.99
IGL03350:Ccdc171 APN 4 83681378 missense possibly damaging 0.67
IGL03377:Ccdc171 APN 4 83663517 missense probably damaging 1.00
PIT4131001:Ccdc171 UTSW 4 83661709
PIT4445001:Ccdc171 UTSW 4 83661747 missense probably damaging 1.00
R0219:Ccdc171 UTSW 4 83696441 splice site probably benign
R0284:Ccdc171 UTSW 4 83549738 missense possibly damaging 0.62
R0355:Ccdc171 UTSW 4 83635682 missense probably damaging 1.00
R1248:Ccdc171 UTSW 4 83681244 missense possibly damaging 0.46
R1278:Ccdc171 UTSW 4 83661858 missense possibly damaging 0.90
R1495:Ccdc171 UTSW 4 83681095 nonsense probably null
R1741:Ccdc171 UTSW 4 83620839 missense probably damaging 0.97
R1742:Ccdc171 UTSW 4 83681284 missense probably damaging 0.99
R1789:Ccdc171 UTSW 4 83554808 missense probably damaging 0.99
R4204:Ccdc171 UTSW 4 83681155 missense probably benign 0.11
R4245:Ccdc171 UTSW 4 83554808 missense probably damaging 0.99
R4502:Ccdc171 UTSW 4 83864323 missense probably damaging 1.00
R4503:Ccdc171 UTSW 4 83864323 missense probably damaging 1.00
R4533:Ccdc171 UTSW 4 83657342 missense possibly damaging 0.66
R4589:Ccdc171 UTSW 4 83549618 missense probably benign 0.11
R4782:Ccdc171 UTSW 4 83681016 missense probably damaging 0.99
R4815:Ccdc171 UTSW 4 83795221 missense probably damaging 1.00
R4868:Ccdc171 UTSW 4 83694332 missense probably damaging 1.00
R4926:Ccdc171 UTSW 4 83558592 intron probably benign
R4937:Ccdc171 UTSW 4 83549639 missense probably damaging 1.00
R5120:Ccdc171 UTSW 4 83558526 intron probably benign
R5185:Ccdc171 UTSW 4 83663655 missense possibly damaging 0.84
R5210:Ccdc171 UTSW 4 83554856 missense probably damaging 1.00
R5243:Ccdc171 UTSW 4 83604107 missense probably damaging 1.00
R5484:Ccdc171 UTSW 4 83693962 missense probably benign 0.00
R5574:Ccdc171 UTSW 4 83693753 missense probably damaging 1.00
R6053:Ccdc171 UTSW 4 83795219 missense probably damaging 1.00
R6135:Ccdc171 UTSW 4 83554850 missense probably benign 0.12
R6140:Ccdc171 UTSW 4 83696317 nonsense probably null
R6339:Ccdc171 UTSW 4 83742997 missense probably damaging 1.00
R6452:Ccdc171 UTSW 4 83864290 missense probably damaging 1.00
R7111:Ccdc171 UTSW 4 83693761 missense probably benign 0.00
R7352:Ccdc171 UTSW 4 83818023 missense possibly damaging 0.82
R7390:Ccdc171 UTSW 4 83818067 missense probably damaging 1.00
R7626:Ccdc171 UTSW 4 83580775 nonsense probably null
R7686:Ccdc171 UTSW 4 83657319 missense unknown
R7705:Ccdc171 UTSW 4 83557956 missense possibly damaging 0.87
R8058:Ccdc171 UTSW 4 83580766 missense probably damaging 0.99
U24488:Ccdc171 UTSW 4 83661717 missense probably damaging 1.00
Z1176:Ccdc171 UTSW 4 83795230 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGTGGACATGTGTCTCTAG -3'
(R):5'- GCACAAGAATGACATAGTGACC -3'

Sequencing Primer
(F):5'- CAGTGGACATGTGTCTCTAGATTGTG -3'
(R):5'- CAAAACAGGGTTTCTCTGTGTAGCC -3'
Posted On2014-06-23