Mutagenetix > Incidental Mutation

Incidental Mutation 'R1801:Ubr4'

203116

Institutional Source

Beutler Lab

Gene Symbol

Ubr4

Ensembl Gene

ENSMUSG00000066036

Gene Name

ubiquitin protein ligase E3 component n-recognin 4

Synonyms

LOC381562, D930005K06Rik, Zubr1, p600, 1810009A16Rik, A930005E13Rik

MMRRC Submission

039831-MU

Accession Numbers

Ncbi RefSeq: NM_001160319.1; MGI:1916366

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139352609-139489588 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 139452563 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125800 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000147999] [ENSMUST00000165860]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000097822

SMART Domains

Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	414	425	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
low complexity region	571	588	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1642	1655	N/A	INTRINSIC
Pfam:zf-UBR	1660	1725	1.9e-9	PFAM
Blast:ZnF_C2H2	1966	1991	6e-8	BLAST
low complexity region	2268	2279	N/A	INTRINSIC
low complexity region	2502	2540	N/A	INTRINSIC
low complexity region	2725	2735	N/A	INTRINSIC
low complexity region	2818	2852	N/A	INTRINSIC
low complexity region	2887	2905	N/A	INTRINSIC
low complexity region	2928	2942	N/A	INTRINSIC
low complexity region	2945	2959	N/A	INTRINSIC
low complexity region	2966	2986	N/A	INTRINSIC
low complexity region	3063	3091	N/A	INTRINSIC
low complexity region	3329	3385	N/A	INTRINSIC
low complexity region	3776	3788	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	4364	5160	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129949

SMART Domains

Protein: ENSMUSP00000115711
Gene: ENSMUSG00000066036

Domain	Start	End	E-Value	Type
low complexity region	24	42	N/A	INTRINSIC
low complexity region	354	367	N/A	INTRINSIC
Pfam:zf-UBR	372	437	2.1e-10	PFAM
Blast:ZnF_C2H2	678	703	5e-8	BLAST
low complexity region	980	991	N/A	INTRINSIC
low complexity region	1225	1263	N/A	INTRINSIC
low complexity region	1448	1458	N/A	INTRINSIC
low complexity region	1575	1593	N/A	INTRINSIC
low complexity region	1616	1630	N/A	INTRINSIC
low complexity region	1633	1647	N/A	INTRINSIC
low complexity region	1654	1674	N/A	INTRINSIC
low complexity region	1751	1779	N/A	INTRINSIC
low complexity region	2017	2045	N/A	INTRINSIC
low complexity region	2048	2065	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000147999

SMART Domains

Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

Domain	Start	End	E-Value	Type
low complexity region	170	226	N/A	INTRINSIC
low complexity region	617	629	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	1205	1301	4.5e-60	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000165860

SMART Domains

Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	414	425	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
low complexity region	571	588	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1642	1655	N/A	INTRINSIC
Pfam:zf-UBR	1659	1729	4e-13	PFAM
Blast:ZnF_C2H2	1966	1991	5e-8	BLAST
low complexity region	2268	2279	N/A	INTRINSIC
low complexity region	2513	2551	N/A	INTRINSIC
low complexity region	2736	2746	N/A	INTRINSIC
low complexity region	2863	2881	N/A	INTRINSIC
low complexity region	2904	2918	N/A	INTRINSIC
low complexity region	2921	2935	N/A	INTRINSIC
low complexity region	2942	2962	N/A	INTRINSIC
low complexity region	3039	3067	N/A	INTRINSIC
low complexity region	3305	3361	N/A	INTRINSIC
low complexity region	3752	3764	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	4340	5136	N/A	PFAM

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.5%

Validation Efficiency

MGI Phenotype

Strain: 5286698
Lethality: D1-D5
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,067,396	E362G	probably damaging	Het
Abcc5	T	C	16: 20,338,887	M1307V	probably benign	Het
Adamts9	A	G	6: 92,863,376	V1142A	probably benign	Het
Ano10	T	C	9: 122,253,030	N525S	probably damaging	Het
Bpifa2	T	C	2: 154,011,504		probably null	Het
C7	C	T	15: 5,012,021	V468I	possibly damaging	Het
Carf	A	T	1: 60,141,505	H362L	possibly damaging	Het
Ccdc171	A	C	4: 83,546,895	I37L	probably benign	Het
Ccdc182	T	C	11: 88,294,190	L32P	possibly damaging	Het
Celsr3	A	T	9: 108,834,626	D1678V	possibly damaging	Het
Col7a1	A	T	9: 108,960,997	Y920F	unknown	Het
Cpsf3	T	C	12: 21,313,790	V627A	probably benign	Het
D7Ertd443e	A	G	7: 134,270,212	M640T	probably damaging	Het
Ddi2	T	C	4: 141,683,972	D543G	probably damaging	Het
Dnah9	T	C	11: 65,955,297	N2972D	probably damaging	Het
Dnajc18	T	C	18: 35,680,804	D304G	probably damaging	Het
Epg5	T	C	18: 77,983,490	V1232A	possibly damaging	Het
Ezr	T	C	17: 6,742,372	T358A	possibly damaging	Het
Filip1	A	G	9: 79,815,846	S1164P	probably damaging	Het
Gm14085	C	T	2: 122,521,652	R324C	possibly damaging	Het
Gm5346	A	T	8: 43,625,917	C423*	probably null	Het
Gmip	T	C	8: 69,814,477	V341A	probably benign	Het
Gnb3	A	C	6: 124,835,636	F286V	probably benign	Het
Gpatch2	T	A	1: 187,225,831	S128T	probably benign	Het
Gpr87	T	C	3: 59,179,392	R231G	possibly damaging	Het
Hip1r	G	A	5: 123,998,808	R613Q	probably benign	Het
Hsd3b7	T	C	7: 127,803,034	Y284H	possibly damaging	Het
Il1rap	A	T	16: 26,698,875	D275V	probably damaging	Het
Il4	G	T	11: 53,618,538	H23Q	possibly damaging	Het
Kit	A	G	5: 75,648,393	Y749C	probably damaging	Het
Klb	A	G	5: 65,349,235	K275R	probably null	Het
Klhl12	G	T	1: 134,489,070	R510L	probably damaging	Het
Lrrc8b	A	G	5: 105,480,823	Y345C	probably damaging	Het
Med15	T	C	16: 17,680,735	T98A	possibly damaging	Het
Mmp1a	T	A	9: 7,475,390	Y387N	probably damaging	Het
Myrf	C	A	19: 10,214,191	V928L	probably benign	Het
Nr1d1	T	C	11: 98,771,499	K134E	probably damaging	Het
Nrxn3	A	T	12: 90,283,582	D305V	probably damaging	Het
Obscn	A	C	11: 58,998,321	S7542A	unknown	Het
Olfr1197	T	A	2: 88,729,264	I112F	probably damaging	Het
Pak4	G	A	7: 28,565,190	R96C	probably damaging	Het
Papd5	T	G	8: 88,250,788	V406G	probably benign	Het
Pde6b	A	T	5: 108,427,847	D691V	possibly damaging	Het
Pdss2	A	G	10: 43,345,605	E171G	probably benign	Het
Pdzd2	C	T	15: 12,387,654	V873I	possibly damaging	Het
Plb1	A	T	5: 32,293,243	D376V	probably damaging	Het
Plekhg1	T	C	10: 3,963,904	Y1209H	probably damaging	Het
Prickle2	A	G	6: 92,416,904	C263R	probably damaging	Het
Psma2	A	T	13: 14,623,605	Y104F	probably benign	Het
Ptger4	T	A	15: 5,242,800	M113L	possibly damaging	Het
Rgs10	T	G	7: 128,404,477	D17A	possibly damaging	Het
Rpap3	A	G	15: 97,694,209	S189P	possibly damaging	Het
Rsbn1	T	C	3: 103,914,872	L102P	probably damaging	Het
Ryr2	T	C	13: 11,595,281	S655G	probably benign	Het
Samd4b	A	T	7: 28,407,331		probably null	Het
Sema4a	C	T	3: 88,436,749	D732N	probably benign	Het
Sh3bp5l	A	G	11: 58,346,351	D378G	probably benign	Het
Sh3gl3	C	T	7: 82,284,119	T230I	possibly damaging	Het
Slc5a1	A	T	5: 33,146,953	Q299L	probably damaging	Het
Ssc5d	C	A	7: 4,936,607	H681N	probably benign	Het
Sugp2	T	C	8: 70,236,710	S10P	possibly damaging	Het
Supt5	A	G	7: 28,317,214		probably null	Het
Syna	A	G	5: 134,560,089	V2A	probably benign	Het
Tcp1	T	A	17: 12,922,202	Y299*	probably null	Het
Tenm3	C	A	8: 48,276,256	V1572L	probably benign	Het
Trp53rka	A	G	2: 165,491,613	S119P	probably damaging	Het
Uchl4	T	A	9: 64,235,475	D79E	probably benign	Het
Vmn2r17	C	A	5: 109,428,478	T405K	probably damaging	Het
Xpnpep1	A	G	19: 53,010,133	L228P	probably damaging	Het
Xrcc4	T	G	13: 89,992,579	E170D	probably damaging	Het
Zfp945	T	C	17: 22,851,762	T388A	probably damaging	Het
Zfp947	G	A	17: 22,146,462	A77V	probably benign	Het
Zkscan5	G	A	5: 145,220,205	G433R	probably damaging	Het

Other mutations in Ubr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ubr4	APN	4	139465322	missense	possibly damaging	0.46
IGL00336:Ubr4	APN	4	139428566	missense	probably damaging	1.00
IGL00586:Ubr4	APN	4	139455184	missense	possibly damaging	0.95
IGL00659:Ubr4	APN	4	139421245	missense	probably damaging	1.00
IGL00766:Ubr4	APN	4	139440766	missense	probably damaging	1.00
IGL00819:Ubr4	APN	4	139476282	missense	possibly damaging	0.92
IGL00833:Ubr4	APN	4	139393159	critical splice donor site	probably null
IGL01126:Ubr4	APN	4	139402555	missense	probably benign	0.04
IGL01311:Ubr4	APN	4	139479045	missense	possibly damaging	0.66
IGL01349:Ubr4	APN	4	139480728	missense	unknown
IGL01388:Ubr4	APN	4	139460243	missense	possibly damaging	0.76
IGL01417:Ubr4	APN	4	139410800	missense	probably damaging	0.99
IGL01446:Ubr4	APN	4	139438040	splice site	probably benign
IGL01449:Ubr4	APN	4	139412736	missense	probably damaging	0.98
IGL01545:Ubr4	APN	4	139442829	splice site	probably benign
IGL01568:Ubr4	APN	4	139421373	missense	probably damaging	1.00
IGL01596:Ubr4	APN	4	139462534	splice site	probably benign
IGL01621:Ubr4	APN	4	139440783	nonsense	probably null
IGL01639:Ubr4	APN	4	139417344	missense	probably damaging	0.99
IGL01655:Ubr4	APN	4	139407796	missense	probably damaging	1.00
IGL01710:Ubr4	APN	4	139418461	missense	possibly damaging	0.81
IGL01830:Ubr4	APN	4	139472500	missense	probably damaging	0.99
IGL01862:Ubr4	APN	4	139477158	missense	possibly damaging	0.66
IGL01868:Ubr4	APN	4	139412678	nonsense	probably null
IGL01874:Ubr4	APN	4	139393289	splice site	probably benign
IGL01889:Ubr4	APN	4	139462472	nonsense	probably null
IGL01891:Ubr4	APN	4	139436260	critical splice donor site	probably null
IGL01980:Ubr4	APN	4	139429602	missense	probably damaging	0.99
IGL02126:Ubr4	APN	4	139452741	critical splice donor site	probably null
IGL02153:Ubr4	APN	4	139460160	nonsense	probably null
IGL02173:Ubr4	APN	4	139437070	splice site	probably null
IGL02214:Ubr4	APN	4	139428583	missense	possibly damaging	0.95
IGL02214:Ubr4	APN	4	139461827	critical splice acceptor site	probably null
IGL02220:Ubr4	APN	4	139388435	missense	probably benign	0.01
IGL02246:Ubr4	APN	4	139459103	missense	possibly damaging	0.89
IGL02264:Ubr4	APN	4	139455628	nonsense	probably null
IGL02273:Ubr4	APN	4	139472578	missense	possibly damaging	0.94
IGL02316:Ubr4	APN	4	139473178	missense	possibly damaging	0.46
IGL02328:Ubr4	APN	4	139478922	missense	probably damaging	0.97
IGL02476:Ubr4	APN	4	139421249	nonsense	probably null
IGL02477:Ubr4	APN	4	139436205	missense	probably damaging	0.98
IGL02544:Ubr4	APN	4	139415118	missense	probably damaging	1.00
IGL02622:Ubr4	APN	4	139467250	nonsense	probably null
IGL02679:Ubr4	APN	4	139459134	missense	probably damaging	0.99
IGL02728:Ubr4	APN	4	139468811	missense	probably damaging	1.00
IGL02754:Ubr4	APN	4	139410784	missense	probably damaging	0.99
IGL02754:Ubr4	APN	4	139393159	critical splice donor site	probably null
IGL02892:Ubr4	APN	4	139417331	missense	probably damaging	0.96
IGL02897:Ubr4	APN	4	139472508	missense	probably damaging	0.97
IGL02946:Ubr4	APN	4	139425295	missense	probably damaging	1.00
IGL02964:Ubr4	APN	4	139407820	missense	possibly damaging	0.84
IGL03059:Ubr4	APN	4	139480676	missense	probably damaging	0.98
IGL03068:Ubr4	APN	4	139409730	missense	probably benign	0.02
IGL03087:Ubr4	APN	4	139450357	nonsense	probably null
IGL03116:Ubr4	APN	4	139479581	splice site	probably benign
IGL03212:Ubr4	APN	4	139409763	missense	probably benign	0.13
IGL03228:Ubr4	APN	4	139429598	missense	probably damaging	1.00
IGL03292:Ubr4	APN	4	139440435	missense	probably damaging	1.00
IGL03388:Ubr4	APN	4	139415032	missense	probably damaging	0.98
IGL03393:Ubr4	APN	4	139452678	missense	probably damaging	1.00
IGL03409:Ubr4	APN	4	139399929	nonsense	probably null
Aqua_regia	UTSW	4	139452719	nonsense	probably null
Eats	UTSW	4	139463575	missense	probably damaging	0.97
Hardened	UTSW	4	139468847	missense	probably damaging	1.00
Stoney	UTSW	4	139444687	missense	probably damaging	1.00
Uber	UTSW	4	139479062	critical splice donor site	probably null
BB001:Ubr4	UTSW	4	139467276	missense	unknown
BB011:Ubr4	UTSW	4	139467276	missense	unknown
P0019:Ubr4	UTSW	4	139451781	missense	probably damaging	1.00
PIT4544001:Ubr4	UTSW	4	139402560	missense	possibly damaging	0.93
R0001:Ubr4	UTSW	4	139451788	missense	probably damaging	1.00
R0002:Ubr4	UTSW	4	139390900	missense	probably damaging	1.00
R0006:Ubr4	UTSW	4	139431649	missense	probably benign	0.03
R0006:Ubr4	UTSW	4	139431649	missense	probably benign	0.03
R0008:Ubr4	UTSW	4	139430176	missense	probably damaging	1.00
R0027:Ubr4	UTSW	4	139400393	missense	probably damaging	0.99
R0027:Ubr4	UTSW	4	139400393	missense	probably damaging	0.99
R0030:Ubr4	UTSW	4	139426793	missense	probably damaging	1.00
R0044:Ubr4	UTSW	4	139437058	splice site	probably benign
R0044:Ubr4	UTSW	4	139437058	splice site	probably benign
R0088:Ubr4	UTSW	4	139440814	missense	probably damaging	1.00
R0131:Ubr4	UTSW	4	139464051	missense	possibly damaging	0.66
R0184:Ubr4	UTSW	4	139445262	missense	probably damaging	1.00
R0219:Ubr4	UTSW	4	139430257	missense	possibly damaging	0.64
R0227:Ubr4	UTSW	4	139431649	missense	probably benign	0.03
R0270:Ubr4	UTSW	4	139479435	splice site	probably benign
R0285:Ubr4	UTSW	4	139440801	missense	probably damaging	1.00
R0322:Ubr4	UTSW	4	139422418	missense	probably damaging	1.00
R0363:Ubr4	UTSW	4	139391860	missense	probably damaging	0.98
R0393:Ubr4	UTSW	4	139410860	splice site	probably benign
R0450:Ubr4	UTSW	4	139430223	missense	probably benign	0.14
R0504:Ubr4	UTSW	4	139406578	missense	probably damaging	1.00
R0504:Ubr4	UTSW	4	139480838	critical splice donor site	probably null
R0510:Ubr4	UTSW	4	139430223	missense	probably benign	0.14
R0513:Ubr4	UTSW	4	139416875	missense	possibly damaging	0.74
R0517:Ubr4	UTSW	4	139392124	missense	probably benign	0.00
R0558:Ubr4	UTSW	4	139426902	missense	probably benign	0.09
R0617:Ubr4	UTSW	4	139479062	critical splice donor site	probably null
R0636:Ubr4	UTSW	4	139436302	splice site	probably null
R0637:Ubr4	UTSW	4	139399615	missense	probably damaging	1.00
R0652:Ubr4	UTSW	4	139401326	missense	probably damaging	0.99
R0691:Ubr4	UTSW	4	139423906	missense	probably damaging	1.00
R0729:Ubr4	UTSW	4	139485320	missense	possibly damaging	0.66
R0735:Ubr4	UTSW	4	139428028	splice site	probably null
R0751:Ubr4	UTSW	4	139437198	splice site	probably benign
R0789:Ubr4	UTSW	4	139410271	critical splice donor site	probably null
R0825:Ubr4	UTSW	4	139479576	critical splice donor site	probably null
R0828:Ubr4	UTSW	4	139450553	splice site	probably benign
R1052:Ubr4	UTSW	4	139455460	missense	possibly damaging	0.83
R1184:Ubr4	UTSW	4	139437198	splice site	probably benign
R1222:Ubr4	UTSW	4	139388471	splice site	probably null
R1258:Ubr4	UTSW	4	139426914	missense	probably damaging	1.00
R1321:Ubr4	UTSW	4	139460123	missense	possibly damaging	0.46
R1385:Ubr4	UTSW	4	139402612	missense	probably benign	0.00
R1450:Ubr4	UTSW	4	139468028	missense	probably damaging	1.00
R1470:Ubr4	UTSW	4	139421226	splice site	probably null
R1470:Ubr4	UTSW	4	139421226	splice site	probably null
R1474:Ubr4	UTSW	4	139429579	missense	probably damaging	1.00
R1479:Ubr4	UTSW	4	139425840	missense	possibly damaging	0.95
R1534:Ubr4	UTSW	4	139428151	missense	possibly damaging	0.95
R1546:Ubr4	UTSW	4	139416927	nonsense	probably null
R1785:Ubr4	UTSW	4	139423945	missense	probably damaging	1.00
R1786:Ubr4	UTSW	4	139423945	missense	probably damaging	1.00
R1789:Ubr4	UTSW	4	139393053	missense	probably damaging	1.00
R1796:Ubr4	UTSW	4	139428596	missense	probably benign	0.25
R1800:Ubr4	UTSW	4	139407963	missense	probably damaging	0.99
R1827:Ubr4	UTSW	4	139425697	critical splice acceptor site	probably null
R1887:Ubr4	UTSW	4	139455560	missense	probably damaging	1.00
R1966:Ubr4	UTSW	4	139451244	critical splice acceptor site	probably null
R2010:Ubr4	UTSW	4	139480652	missense	possibly damaging	0.92
R2049:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2069:Ubr4	UTSW	4	139479540	missense	possibly damaging	0.66
R2114:Ubr4	UTSW	4	139429611	nonsense	probably null
R2140:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2141:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2142:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2168:Ubr4	UTSW	4	139410649	missense	probably benign	0.25
R2237:Ubr4	UTSW	4	139442790	missense	probably damaging	1.00
R2249:Ubr4	UTSW	4	139448921	missense	probably damaging	1.00
R2261:Ubr4	UTSW	4	139413462	missense	probably damaging	0.99
R2264:Ubr4	UTSW	4	139420373	splice site	probably benign
R2353:Ubr4	UTSW	4	139433673	missense	possibly damaging	0.48
R2437:Ubr4	UTSW	4	139473542	missense	possibly damaging	0.90
R2496:Ubr4	UTSW	4	139473205	unclassified	probably benign
R2896:Ubr4	UTSW	4	139455644	splice site	probably null
R2922:Ubr4	UTSW	4	139479500	missense	possibly damaging	0.66
R2972:Ubr4	UTSW	4	139406536	missense	probably benign	0.22
R2973:Ubr4	UTSW	4	139406536	missense	probably benign	0.22
R2989:Ubr4	UTSW	4	139463558	missense	possibly damaging	0.89
R3176:Ubr4	UTSW	4	139421855	missense	probably benign	0.03
R3276:Ubr4	UTSW	4	139421855	missense	probably benign	0.03
R3772:Ubr4	UTSW	4	139452700	missense	possibly damaging	0.89
R3844:Ubr4	UTSW	4	139459126	missense	probably damaging	0.99
R3873:Ubr4	UTSW	4	139423990	missense	probably damaging	1.00
R3900:Ubr4	UTSW	4	139479062	critical splice donor site	probably null
R3951:Ubr4	UTSW	4	139393094	missense	probably damaging	1.00
R4020:Ubr4	UTSW	4	139451805	missense	probably damaging	0.98
R4178:Ubr4	UTSW	4	139393414	missense	probably damaging	1.00
R4308:Ubr4	UTSW	4	139472509	missense	possibly damaging	0.46
R4378:Ubr4	UTSW	4	139410440	missense	possibly damaging	0.76
R4400:Ubr4	UTSW	4	139461856	missense	possibly damaging	0.66
R4421:Ubr4	UTSW	4	139461856	missense	possibly damaging	0.66
R4462:Ubr4	UTSW	4	139418502	missense	possibly damaging	0.47
R4583:Ubr4	UTSW	4	139380853	missense	possibly damaging	0.82
R4611:Ubr4	UTSW	4	139399579	missense	possibly damaging	0.93
R4664:Ubr4	UTSW	4	139406518	missense	possibly damaging	0.56
R4671:Ubr4	UTSW	4	139436191	missense	possibly damaging	0.66
R4672:Ubr4	UTSW	4	139410716	missense	probably damaging	0.99
R4673:Ubr4	UTSW	4	139410716	missense	probably damaging	0.99
R4696:Ubr4	UTSW	4	139408672	missense	probably benign	0.09
R4701:Ubr4	UTSW	4	139471336	missense	possibly damaging	0.66
R4705:Ubr4	UTSW	4	139450529	missense	probably damaging	1.00
R4726:Ubr4	UTSW	4	139482579	missense	possibly damaging	0.46
R4728:Ubr4	UTSW	4	139423879	missense	probably damaging	1.00
R4783:Ubr4	UTSW	4	139421733	missense	possibly damaging	0.85
R4833:Ubr4	UTSW	4	139402546	missense	probably damaging	0.98
R4892:Ubr4	UTSW	4	139428517	missense	probably benign	0.14
R4936:Ubr4	UTSW	4	139396566	missense	probably damaging	0.98
R5000:Ubr4	UTSW	4	139436169	missense	probably damaging	0.98
R5114:Ubr4	UTSW	4	139410623	missense	probably damaging	0.99
R5189:Ubr4	UTSW	4	139410649	missense	probably benign	0.25
R5197:Ubr4	UTSW	4	139468097	missense	probably damaging	1.00
R5213:Ubr4	UTSW	4	139402566	nonsense	probably null
R5219:Ubr4	UTSW	4	139477232	nonsense	probably null
R5346:Ubr4	UTSW	4	139428491	missense	probably damaging	0.97
R5368:Ubr4	UTSW	4	139397528	intron	probably benign
R5442:Ubr4	UTSW	4	139407772	missense	probably damaging	1.00
R5527:Ubr4	UTSW	4	139480788	missense	possibly damaging	0.83
R5548:Ubr4	UTSW	4	139460090	missense	probably damaging	0.97
R5568:Ubr4	UTSW	4	139392038	missense	probably damaging	0.99
R5639:Ubr4	UTSW	4	139452648	missense	possibly damaging	0.66
R5643:Ubr4	UTSW	4	139444687	missense	probably damaging	1.00
R5663:Ubr4	UTSW	4	139428583	missense	possibly damaging	0.95
R5755:Ubr4	UTSW	4	139460095	missense	possibly damaging	0.66
R5781:Ubr4	UTSW	4	139468096	missense	probably damaging	1.00
R5784:Ubr4	UTSW	4	139425218	missense	probably damaging	1.00
R5817:Ubr4	UTSW	4	139468847	missense	probably damaging	1.00
R5872:Ubr4	UTSW	4	139425330	missense	probably damaging	0.98
R5891:Ubr4	UTSW	4	139408626	nonsense	probably null
R5901:Ubr4	UTSW	4	139451254	missense	probably damaging	1.00
R5958:Ubr4	UTSW	4	139455638	missense	probably damaging	1.00
R5974:Ubr4	UTSW	4	139421078	splice site	probably null
R6065:Ubr4	UTSW	4	139421238	missense	probably damaging	1.00
R6109:Ubr4	UTSW	4	139417364	missense	probably damaging	0.99
R6207:Ubr4	UTSW	4	139421248	missense	probably damaging	1.00
R6265:Ubr4	UTSW	4	139452640	missense	possibly damaging	0.90
R6319:Ubr4	UTSW	4	139408889	missense	possibly damaging	0.84
R6342:Ubr4	UTSW	4	139429539	missense	possibly damaging	0.88
R6434:Ubr4	UTSW	4	139429638	missense	probably damaging	1.00
R6437:Ubr4	UTSW	4	139397214	critical splice donor site	probably null
R6481:Ubr4	UTSW	4	139431751	missense	probably damaging	0.97
R6502:Ubr4	UTSW	4	139444671	missense	probably damaging	1.00
R6546:Ubr4	UTSW	4	139414394	missense	probably damaging	0.99
R6603:Ubr4	UTSW	4	139455586	missense	probably benign	0.17
R6648:Ubr4	UTSW	4	139452719	nonsense	probably null
R6649:Ubr4	UTSW	4	139473624	missense	possibly damaging	0.66
R6653:Ubr4	UTSW	4	139473624	missense	possibly damaging	0.66
R6668:Ubr4	UTSW	4	139465341	missense	probably damaging	1.00
R6770:Ubr4	UTSW	4	139489182	missense	unknown
R6772:Ubr4	UTSW	4	139467230	nonsense	probably null
R6857:Ubr4	UTSW	4	139486051	missense	possibly damaging	0.90
R6869:Ubr4	UTSW	4	139467227	missense	possibly damaging	0.93
R6912:Ubr4	UTSW	4	139458234	critical splice donor site	probably null
R6943:Ubr4	UTSW	4	139437131	nonsense	probably null
R6970:Ubr4	UTSW	4	139406528	nonsense	probably null
R6976:Ubr4	UTSW	4	139393077	missense	probably damaging	0.98
R7000:Ubr4	UTSW	4	139414404	missense	probably damaging	1.00
R7017:Ubr4	UTSW	4	139393090	missense	probably damaging	0.99
R7165:Ubr4	UTSW	4	139450513	missense
R7222:Ubr4	UTSW	4	139463373	missense	unknown
R7241:Ubr4	UTSW	4	139443414	missense	probably damaging	1.00
R7343:Ubr4	UTSW	4	139413438	missense	probably benign	0.09
R7367:Ubr4	UTSW	4	139452691	missense	unknown
R7393:Ubr4	UTSW	4	139426785	missense	probably damaging	1.00
R7432:Ubr4	UTSW	4	139388382	missense	probably damaging	1.00
R7448:Ubr4	UTSW	4	139462467	missense	unknown
R7502:Ubr4	UTSW	4	139412672	missense	possibly damaging	0.72
R7514:Ubr4	UTSW	4	139452655	missense	unknown
R7526:Ubr4	UTSW	4	139422417	missense	probably benign	0.00
R7529:Ubr4	UTSW	4	139422417	missense	probably benign	0.00
R7666:Ubr4	UTSW	4	139413480	missense	possibly damaging	0.81
R7699:Ubr4	UTSW	4	139408867	nonsense	probably null
R7700:Ubr4	UTSW	4	139408867	nonsense	probably null
R7726:Ubr4	UTSW	4	139458920	missense	unknown
R7753:Ubr4	UTSW	4	139470292	missense	unknown
R7810:Ubr4	UTSW	4	139415083	missense
R7837:Ubr4	UTSW	4	139393151	nonsense	probably null
R7868:Ubr4	UTSW	4	139460033	missense	unknown
R7872:Ubr4	UTSW	4	139393062	missense	possibly damaging	0.94
R7887:Ubr4	UTSW	4	139407810	missense	probably damaging	0.99
R7924:Ubr4	UTSW	4	139467276	missense	unknown
R7980:Ubr4	UTSW	4	139418406	missense
R7982:Ubr4	UTSW	4	139428208	critical splice donor site	probably null
R8005:Ubr4	UTSW	4	139412630	missense	probably damaging	0.98
R8054:Ubr4	UTSW	4	139468102	missense	unknown
R8094:Ubr4	UTSW	4	139440696	missense	probably damaging	0.97
R8151:Ubr4	UTSW	4	139402801	missense	probably damaging	0.97
R8183:Ubr4	UTSW	4	139482471	missense	unknown
R8252:Ubr4	UTSW	4	139473217	missense	unknown
R8505:Ubr4	UTSW	4	139429569	missense
R8519:Ubr4	UTSW	4	139416647	missense	probably damaging	0.97
R8716:Ubr4	UTSW	4	139468853	missense	unknown
R8720:Ubr4	UTSW	4	139480838	critical splice donor site	probably null
R8749:Ubr4	UTSW	4	139402624	missense	probably damaging	0.98
R8768:Ubr4	UTSW	4	139421765	missense
R8789:Ubr4	UTSW	4	139410183	missense	possibly damaging	0.76
R8879:Ubr4	UTSW	4	139410518	missense	probably benign	0.06
R8937:Ubr4	UTSW	4	139463575	missense	probably damaging	0.97
R9006:Ubr4	UTSW	4	139444692	critical splice donor site	probably null
R9116:Ubr4	UTSW	4	139418474	missense
R9134:Ubr4	UTSW	4	139400444	critical splice donor site	probably null
R9251:Ubr4	UTSW	4	139450325	missense
R9340:Ubr4	UTSW	4	139455452	missense	unknown
R9384:Ubr4	UTSW	4	139467320	missense	unknown
R9389:Ubr4	UTSW	4	139425924	missense
R9393:Ubr4	UTSW	4	139485302	missense	unknown
R9531:Ubr4	UTSW	4	139407906	missense	probably benign	0.00
R9573:Ubr4	UTSW	4	139421139	missense
R9604:Ubr4	UTSW	4	139432516	critical splice donor site	probably null
R9613:Ubr4	UTSW	4	139421762	missense
R9623:Ubr4	UTSW	4	139431713	missense	probably benign	0.00
R9651:Ubr4	UTSW	4	139479548	missense	unknown
R9685:Ubr4	UTSW	4	139464030	missense	unknown
R9698:Ubr4	UTSW	4	139440664	missense
R9700:Ubr4	UTSW	4	139392077	missense	probably damaging	0.97
R9727:Ubr4	UTSW	4	139413424	missense	probably damaging	0.98
R9766:Ubr4	UTSW	4	139467284	missense	unknown
T0975:Ubr4	UTSW	4	139451781	missense	probably damaging	1.00
X0028:Ubr4	UTSW	4	139410271	critical splice donor site	probably null
Z1176:Ubr4	UTSW	4	139400385	missense	probably damaging	1.00
Z1176:Ubr4	UTSW	4	139402660	missense	probably benign	0.04
Z1176:Ubr4	UTSW	4	139410145	missense	probably damaging	1.00
Z1177:Ubr4	UTSW	4	139450481	missense
Z1186:Ubr4	UTSW	4	139410653	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TATTCAGGCCTGCTGTAGCTG -3'
(R):5'- AGATGTGCAGTGTCAGGCAG -3'

Sequencing Primer
(F):5'- AGTGCCAGGCTTACTGTCCTG -3'
(R):5'- AGTGTCAGGCAGTGGGC -3'

Posted On

2014-06-23