Mutagenetix > Incidental Mutation

Incidental Mutation 'R1801:Klb'

203120

Institutional Source

Beutler Lab

Gene Symbol

Klb

Ensembl Gene

ENSMUSG00000029195

Gene Name

klotho beta

Synonyms

betaKlotho

MMRRC Submission

039831-MU

Accession Numbers

Genbank: NM_031180.2; Ensembl: ENSMUST00000031096;

MGI:1932466

Essential gene?

Probably essential (E-score: 0.918) question?

Stock #

R1801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65348314-65384007 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65349235 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 275 (K275R)

Ref Sequence

ENSEMBL: ENSMUSP00000031096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031096] [ENSMUST00000205084]

AlphaFold

Q99N32

Predicted Effect

probably null
Transcript: ENSMUST00000031096
AA Change: K275R

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000031096
Gene: ENSMUSG00000029195
AA Change: K275R

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	77	385	8.8e-96	PFAM
Pfam:Glyco_hydro_1	374	506	1.7e-31	PFAM
Pfam:Glyco_hydro_1	515	965	6.3e-80	PFAM
transmembrane domain	995	1017	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203333

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205084
AA Change: K275R

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000145091
Gene: ENSMUSG00000029195
AA Change: K275R

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	77	360	8.6e-94	PFAM

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.5%

Validation Efficiency

MGI Phenotype

Strain: 3587748
PHENOTYPE: Homozygous null mice display increased bile acid synthesis and excretion, resistance to gallstone formation, and slightly decreased body weight. Mice homozygous for a knock-out allele or a conditional allele activated in adipose tissue exhibit resistanceto FGF21-induced metabolic disruptions. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,067,396	E362G	probably damaging	Het
Abcc5	T	C	16: 20,338,887	M1307V	probably benign	Het
Adamts9	A	G	6: 92,863,376	V1142A	probably benign	Het
Ano10	T	C	9: 122,253,030	N525S	probably damaging	Het
Bpifa2	T	C	2: 154,011,504		probably null	Het
C7	C	T	15: 5,012,021	V468I	possibly damaging	Het
Carf	A	T	1: 60,141,505	H362L	possibly damaging	Het
Ccdc171	A	C	4: 83,546,895	I37L	probably benign	Het
Ccdc182	T	C	11: 88,294,190	L32P	possibly damaging	Het
Celsr3	A	T	9: 108,834,626	D1678V	possibly damaging	Het
Col7a1	A	T	9: 108,960,997	Y920F	unknown	Het
Cpsf3	T	C	12: 21,313,790	V627A	probably benign	Het
D7Ertd443e	A	G	7: 134,270,212	M640T	probably damaging	Het
Ddi2	T	C	4: 141,683,972	D543G	probably damaging	Het
Dnah9	T	C	11: 65,955,297	N2972D	probably damaging	Het
Dnajc18	T	C	18: 35,680,804	D304G	probably damaging	Het
Epg5	T	C	18: 77,983,490	V1232A	possibly damaging	Het
Ezr	T	C	17: 6,742,372	T358A	possibly damaging	Het
Filip1	A	G	9: 79,815,846	S1164P	probably damaging	Het
Gm14085	C	T	2: 122,521,652	R324C	possibly damaging	Het
Gm5346	A	T	8: 43,625,917	C423*	probably null	Het
Gmip	T	C	8: 69,814,477	V341A	probably benign	Het
Gnb3	A	C	6: 124,835,636	F286V	probably benign	Het
Gpatch2	T	A	1: 187,225,831	S128T	probably benign	Het
Gpr87	T	C	3: 59,179,392	R231G	possibly damaging	Het
Hip1r	G	A	5: 123,998,808	R613Q	probably benign	Het
Hsd3b7	T	C	7: 127,803,034	Y284H	possibly damaging	Het
Il1rap	A	T	16: 26,698,875	D275V	probably damaging	Het
Il4	G	T	11: 53,618,538	H23Q	possibly damaging	Het
Kit	A	G	5: 75,648,393	Y749C	probably damaging	Het
Klhl12	G	T	1: 134,489,070	R510L	probably damaging	Het
Lrrc8b	A	G	5: 105,480,823	Y345C	probably damaging	Het
Med15	T	C	16: 17,680,735	T98A	possibly damaging	Het
Mmp1a	T	A	9: 7,475,390	Y387N	probably damaging	Het
Myrf	C	A	19: 10,214,191	V928L	probably benign	Het
Nr1d1	T	C	11: 98,771,499	K134E	probably damaging	Het
Nrxn3	A	T	12: 90,283,582	D305V	probably damaging	Het
Obscn	A	C	11: 58,998,321	S7542A	unknown	Het
Olfr1197	T	A	2: 88,729,264	I112F	probably damaging	Het
Pak4	G	A	7: 28,565,190	R96C	probably damaging	Het
Papd5	T	G	8: 88,250,788	V406G	probably benign	Het
Pde6b	A	T	5: 108,427,847	D691V	possibly damaging	Het
Pdss2	A	G	10: 43,345,605	E171G	probably benign	Het
Pdzd2	C	T	15: 12,387,654	V873I	possibly damaging	Het
Plb1	A	T	5: 32,293,243	D376V	probably damaging	Het
Plekhg1	T	C	10: 3,963,904	Y1209H	probably damaging	Het
Prickle2	A	G	6: 92,416,904	C263R	probably damaging	Het
Psma2	A	T	13: 14,623,605	Y104F	probably benign	Het
Ptger4	T	A	15: 5,242,800	M113L	possibly damaging	Het
Rgs10	T	G	7: 128,404,477	D17A	possibly damaging	Het
Rpap3	A	G	15: 97,694,209	S189P	possibly damaging	Het
Rsbn1	T	C	3: 103,914,872	L102P	probably damaging	Het
Ryr2	T	C	13: 11,595,281	S655G	probably benign	Het
Samd4b	A	T	7: 28,407,331		probably null	Het
Sema4a	C	T	3: 88,436,749	D732N	probably benign	Het
Sh3bp5l	A	G	11: 58,346,351	D378G	probably benign	Het
Sh3gl3	C	T	7: 82,284,119	T230I	possibly damaging	Het
Slc5a1	A	T	5: 33,146,953	Q299L	probably damaging	Het
Ssc5d	C	A	7: 4,936,607	H681N	probably benign	Het
Sugp2	T	C	8: 70,236,710	S10P	possibly damaging	Het
Supt5	A	G	7: 28,317,214		probably null	Het
Syna	A	G	5: 134,560,089	V2A	probably benign	Het
Tcp1	T	A	17: 12,922,202	Y299*	probably null	Het
Tenm3	C	A	8: 48,276,256	V1572L	probably benign	Het
Trp53rka	A	G	2: 165,491,613	S119P	probably damaging	Het
Ubr4	T	A	4: 139,452,563		probably null	Het
Uchl4	T	A	9: 64,235,475	D79E	probably benign	Het
Vmn2r17	C	A	5: 109,428,478	T405K	probably damaging	Het
Xpnpep1	A	G	19: 53,010,133	L228P	probably damaging	Het
Xrcc4	T	G	13: 89,992,579	E170D	probably damaging	Het
Zfp945	T	C	17: 22,851,762	T388A	probably damaging	Het
Zfp947	G	A	17: 22,146,462	A77V	probably benign	Het
Zkscan5	G	A	5: 145,220,205	G433R	probably damaging	Het

Other mutations in Klb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Klb	APN	5	65372374	missense	possibly damaging	0.90
IGL00821:Klb	APN	5	65372149	missense	probably damaging	1.00
IGL01082:Klb	APN	5	65375940	missense	possibly damaging	0.71
IGL01637:Klb	APN	5	65375679	critical splice acceptor site	probably null
IGL02098:Klb	APN	5	65379885	missense	probably benign	0.21
IGL03113:Klb	APN	5	65383470	missense	probably benign	0.00
1mM(1):Klb	UTSW	5	65348650	missense	probably damaging	1.00
P0016:Klb	UTSW	5	65379923	nonsense	probably null
R0268:Klb	UTSW	5	65348837	missense	probably benign	0.02
R0383:Klb	UTSW	5	65372499	splice site	probably null
R0676:Klb	UTSW	5	65379055	missense	probably damaging	1.00
R0735:Klb	UTSW	5	65379727	missense	probably benign
R0972:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1051:Klb	UTSW	5	65379327	missense	probably damaging	1.00
R1168:Klb	UTSW	5	65378974	missense	probably damaging	1.00
R1372:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1403:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1403:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1446:Klb	UTSW	5	65348995	missense	probably damaging	1.00
R1696:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1743:Klb	UTSW	5	65375861	missense	probably damaging	0.99
R1804:Klb	UTSW	5	65379853	missense	probably damaging	1.00
R1848:Klb	UTSW	5	65348837	missense	probably benign	0.02
R1967:Klb	UTSW	5	65372074	missense	probably damaging	0.98
R3420:Klb	UTSW	5	65372142	missense	probably damaging	1.00
R4397:Klb	UTSW	5	65380039	missense	probably damaging	1.00
R4490:Klb	UTSW	5	65375794	missense	probably benign	0.02
R4491:Klb	UTSW	5	65375794	missense	probably benign	0.02
R4547:Klb	UTSW	5	65379928	missense	probably benign	0.00
R4878:Klb	UTSW	5	65348490	missense	probably damaging	0.99
R5269:Klb	UTSW	5	65348797	missense	probably damaging	1.00
R5418:Klb	UTSW	5	65383470	missense	probably benign	0.00
R5453:Klb	UTSW	5	65383385	missense	probably benign	0.08
R5541:Klb	UTSW	5	65379234	missense	probably benign	0.27
R5672:Klb	UTSW	5	65379949	missense	possibly damaging	0.82
R5841:Klb	UTSW	5	65379324	nonsense	probably null
R6088:Klb	UTSW	5	65349013	missense	probably benign	0.07
R6807:Klb	UTSW	5	65379534	missense	probably damaging	1.00
R6955:Klb	UTSW	5	65379088	nonsense	probably null
R7068:Klb	UTSW	5	65379340	missense	probably damaging	1.00
R7284:Klb	UTSW	5	65383478	missense	probably benign	0.01
R7322:Klb	UTSW	5	65383364	missense	probably benign	0.44
R7346:Klb	UTSW	5	65348631	nonsense	probably null
R7366:Klb	UTSW	5	65372431	missense	probably damaging	1.00
R8134:Klb	UTSW	5	65383615	missense	probably benign	0.00
R8243:Klb	UTSW	5	65378995	missense	possibly damaging	0.65
R8409:Klb	UTSW	5	65379535	missense	probably damaging	0.96
R8971:Klb	UTSW	5	65375683	missense	probably damaging	1.00
R9193:Klb	UTSW	5	65372025	missense	possibly damaging	0.63
R9305:Klb	UTSW	5	65348645	nonsense	probably null
R9390:Klb	UTSW	5	65375701	missense	possibly damaging	0.50
R9531:Klb	UTSW	5	65383605	missense
R9768:Klb	UTSW	5	65380030	missense	probably damaging	1.00
Z1177:Klb	UTSW	5	65348741	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCAACGACTATGCCACATACTG -3'
(R):5'- CTCAAAGGGCAGCTGTGAAG -3'

Sequencing Primer
(F):5'- GACTATGCCACATACTGCTTCCAG -3'
(R):5'- TTAGTACTGATCGTGGAAGATGAGAC -3'

Posted On

2014-06-23