Mutagenetix > Incidental Mutations

Incidental Mutation 'R1801:Pde6b'

203123

Institutional Source

Beutler Lab

Gene Symbol

Pde6b

Ensembl Gene

ENSMUSG00000029491

Gene Name

phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide

Synonyms

rd10, Pdeb, rd, rd1, r

MMRRC Submission

039831-MU

Accession Numbers

Genbank: NM_008806; MGI: 97525

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108388391-108432397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108427847 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 691 (D691V)

Ref Sequence

ENSEMBL: ENSMUSP00000031456 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031456]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031456
AA Change: D691V

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000031456
Gene: ENSMUSG00000029491
AA Change: D691V

Domain	Start	End	E-Value	Type
GAF	71	230	1.29e-27	SMART
GAF	252	439	5.76e-25	SMART
Blast:HDc	484	538	1e-24	BLAST
HDc	554	732	1.25e-9	SMART
Blast:HDc	757	792	8e-13	BLAST
low complexity region	813	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130448

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134865

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for the rd1 mutation have severe retinal degeneration and vision loss. Rod cells are lost by 35 days of age; cone cells degenerate slower and some light sensitivity persists. Other allelic mutations produce similar or milder phenotypes. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(9)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,067,396	E362G	probably damaging	Het
Abcc5	T	C	16: 20,338,887	M1307V	probably benign	Het
Adamts9	A	G	6: 92,863,376	V1142A	probably benign	Het
Ano10	T	C	9: 122,253,030	N525S	probably damaging	Het
Bpifa2	T	C	2: 154,011,504		probably null	Het
C7	C	T	15: 5,012,021	V468I	possibly damaging	Het
Carf	A	T	1: 60,141,505	H362L	possibly damaging	Het
Ccdc171	A	C	4: 83,546,895	I37L	probably benign	Het
Ccdc182	T	C	11: 88,294,190	L32P	possibly damaging	Het
Celsr3	A	T	9: 108,834,626	D1678V	possibly damaging	Het
Col7a1	A	T	9: 108,960,997	Y920F	unknown	Het
Cpsf3	T	C	12: 21,313,790	V627A	probably benign	Het
D7Ertd443e	A	G	7: 134,270,212	M640T	probably damaging	Het
Ddi2	T	C	4: 141,683,972	D543G	probably damaging	Het
Dnah9	T	C	11: 65,955,297	N2972D	probably damaging	Het
Dnajc18	T	C	18: 35,680,804	D304G	probably damaging	Het
Epg5	T	C	18: 77,983,490	V1232A	possibly damaging	Het
Ezr	T	C	17: 6,742,372	T358A	possibly damaging	Het
Filip1	A	G	9: 79,815,846	S1164P	probably damaging	Het
Gm14085	C	T	2: 122,521,652	R324C	possibly damaging	Het
Gm5346	A	T	8: 43,625,917	C423*	probably null	Het
Gmip	T	C	8: 69,814,477	V341A	probably benign	Het
Gnb3	A	C	6: 124,835,636	F286V	probably benign	Het
Gpatch2	T	A	1: 187,225,831	S128T	probably benign	Het
Gpr87	T	C	3: 59,179,392	R231G	possibly damaging	Het
Hip1r	G	A	5: 123,998,808	R613Q	probably benign	Het
Hsd3b7	T	C	7: 127,803,034	Y284H	possibly damaging	Het
Il1rap	A	T	16: 26,698,875	D275V	probably damaging	Het
Il4	G	T	11: 53,618,538	H23Q	possibly damaging	Het
Kit	A	G	5: 75,648,393	Y749C	probably damaging	Het
Klb	A	G	5: 65,349,235	K275R	probably null	Het
Klhl12	G	T	1: 134,489,070	R510L	probably damaging	Het
Lrrc8b	A	G	5: 105,480,823	Y345C	probably damaging	Het
Med15	T	C	16: 17,680,735	T98A	possibly damaging	Het
Mmp1a	T	A	9: 7,475,390	Y387N	probably damaging	Het
Myrf	C	A	19: 10,214,191	V928L	probably benign	Het
Nr1d1	T	C	11: 98,771,499	K134E	probably damaging	Het
Nrxn3	A	T	12: 90,283,582	D305V	probably damaging	Het
Obscn	A	C	11: 58,998,321	S7542A	unknown	Het
Olfr1197	T	A	2: 88,729,264	I112F	probably damaging	Het
Pak4	G	A	7: 28,565,190	R96C	probably damaging	Het
Papd5	T	G	8: 88,250,788	V406G	probably benign	Het
Pdss2	A	G	10: 43,345,605	E171G	probably benign	Het
Pdzd2	C	T	15: 12,387,654	V873I	possibly damaging	Het
Plb1	A	T	5: 32,293,243	D376V	probably damaging	Het
Plekhg1	T	C	10: 3,963,904	Y1209H	probably damaging	Het
Prickle2	A	G	6: 92,416,904	C263R	probably damaging	Het
Psma2	A	T	13: 14,623,605	Y104F	probably benign	Het
Ptger4	T	A	15: 5,242,800	M113L	possibly damaging	Het
Rgs10	T	G	7: 128,404,477	D17A	possibly damaging	Het
Rpap3	A	G	15: 97,694,209	S189P	possibly damaging	Het
Rsbn1	T	C	3: 103,914,872	L102P	probably damaging	Het
Ryr2	T	C	13: 11,595,281	S655G	probably benign	Het
Samd4b	A	T	7: 28,407,331		probably null	Het
Sema4a	C	T	3: 88,436,749	D732N	probably benign	Het
Sh3bp5l	A	G	11: 58,346,351	D378G	probably benign	Het
Sh3gl3	C	T	7: 82,284,119	T230I	possibly damaging	Het
Slc5a1	A	T	5: 33,146,953	Q299L	probably damaging	Het
Ssc5d	C	A	7: 4,936,607	H681N	probably benign	Het
Sugp2	T	C	8: 70,236,710	S10P	possibly damaging	Het
Supt5	A	G	7: 28,317,214		probably null	Het
Syna	A	G	5: 134,560,089	V2A	probably benign	Het
Tcp1	T	A	17: 12,922,202	Y299*	probably null	Het
Tenm3	C	A	8: 48,276,256	V1572L	probably benign	Het
Trp53rka	A	G	2: 165,491,613	S119P	probably damaging	Het
Ubr4	T	A	4: 139,452,563		probably null	Het
Uchl4	T	A	9: 64,235,475	D79E	probably benign	Het
Vmn2r17	C	A	5: 109,428,478	T405K	probably damaging	Het
Xpnpep1	A	G	19: 53,010,133	L228P	probably damaging	Het
Xrcc4	T	G	13: 89,992,579	E170D	probably damaging	Het
Zfp945	T	C	17: 22,851,762	T388A	probably damaging	Het
Zfp947	G	A	17: 22,146,462	A77V	probably benign	Het
Zkscan5	G	A	5: 145,220,205	G433R	probably damaging	Het

Other mutations in Pde6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Pde6b	APN	5	108426571	splice site	probably benign
IGL01071:Pde6b	APN	5	108419715	nonsense	probably null
IGL01335:Pde6b	APN	5	108423513	missense	probably benign	0.03
IGL01611:Pde6b	APN	5	108403396	missense	possibly damaging	0.90
IGL01881:Pde6b	APN	5	108421500	missense	probably benign	0.01
IGL01941:Pde6b	APN	5	108423036	missense	probably benign	0.11
IGL02616:Pde6b	APN	5	108431541	missense	probably benign	0.05
IGL02657:Pde6b	APN	5	108420276	splice site	probably benign
IGL03217:Pde6b	APN	5	108419566	missense	probably damaging	1.00
Bemr28	UTSW	5		unclassified
D4043:Pde6b	UTSW	5	108425356	nonsense	probably null
N/A:Pde6b	UTSW	5	108429103	unclassified	probably benign
PIT4362001:Pde6b	UTSW	5	108423585	critical splice donor site	probably null
PIT4581001:Pde6b	UTSW	5	108428508	missense	probably benign	0.01
R0940:Pde6b	UTSW	5	108420337	missense	possibly damaging	0.95
R0963:Pde6b	UTSW	5	108430668	missense	probably benign
R1738:Pde6b	UTSW	5	108430559	nonsense	probably null
R1753:Pde6b	UTSW	5	108388691	nonsense	probably null
R1913:Pde6b	UTSW	5	108427190	missense	probably benign	0.05
R2131:Pde6b	UTSW	5	108428203	missense	probably damaging	1.00
R2282:Pde6b	UTSW	5	108423586	splice site	probably null
R3713:Pde6b	UTSW	5	108423062	missense	probably damaging	1.00
R4385:Pde6b	UTSW	5	108427642	missense	probably benign	0.08
R4562:Pde6b	UTSW	5	108403368	missense	probably benign	0.23
R4582:Pde6b	UTSW	5	108425231	critical splice acceptor site	probably null
R4939:Pde6b	UTSW	5	108421497	missense	probably benign	0.01
R4950:Pde6b	UTSW	5	108430703	missense	probably benign	0.16
R4972:Pde6b	UTSW	5	108425264	missense	probably benign	0.00
R4983:Pde6b	UTSW	5	108425330	missense	probably benign	0.21
R5056:Pde6b	UTSW	5	108423491	nonsense	probably null
R5514:Pde6b	UTSW	5	108423451	missense	probably benign	0.06
R5528:Pde6b	UTSW	5	108423558	missense	probably benign	0.04
R5937:Pde6b	UTSW	5	108424327	missense	probably benign	0.00
R6556:Pde6b	UTSW	5	108421501	missense	possibly damaging	0.56
R6826:Pde6b	UTSW	5	108430592	nonsense	probably null
R6884:Pde6b	UTSW	5	108388708	missense	probably damaging	0.99
R7213:Pde6b	UTSW	5	108404090	missense	probably damaging	1.00
R7444:Pde6b	UTSW	5	108427142	nonsense	probably null
R7690:Pde6b	UTSW	5	108419518	missense	probably damaging	1.00
R7909:Pde6b	UTSW	5	108403422	missense	probably benign	0.01
R7937:Pde6b	UTSW	5	108419773	critical splice donor site	probably null
R8049:Pde6b	UTSW	5	108425252	missense	probably benign	0.04
R8087:Pde6b	UTSW	5	108388462	missense	probably benign	0.00
R8698:Pde6b	UTSW	5	108428239	missense	possibly damaging	0.87
R8822:Pde6b	UTSW	5	108403462	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGCATGAACATGTGATCCAC -3'
(R):5'- TCAGGGGTGCTAAGGAAGATTC -3'

Sequencing Primer
(F):5'- TGAACATGTGATCCACCTCATG -3'
(R):5'- TGCTAAGGAAGATTCTGGATTCAG -3'

Posted On

2014-06-23