Incidental Mutation 'R1801:Vmn2r17'
ID203124
Institutional Source Beutler Lab
Gene Symbol Vmn2r17
Ensembl Gene ENSMUSG00000091879
Gene Namevomeronasal 2, receptor 17
SynonymsEG384221
MMRRC Submission 039831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1801 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location109420013-109453387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109428478 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 405 (T405K)
Ref Sequence ENSEMBL: ENSMUSP00000131450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171841]
Predicted Effect probably damaging
Transcript: ENSMUST00000171841
AA Change: T405K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131450
Gene: ENSMUSG00000091879
AA Change: T405K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 465 7e-26 PFAM
Pfam:NCD3G 508 562 3.5e-18 PFAM
Pfam:7tm_3 593 830 4.8e-55 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,396 E362G probably damaging Het
Abcc5 T C 16: 20,338,887 M1307V probably benign Het
Adamts9 A G 6: 92,863,376 V1142A probably benign Het
Ano10 T C 9: 122,253,030 N525S probably damaging Het
Bpifa2 T C 2: 154,011,504 probably null Het
C7 C T 15: 5,012,021 V468I possibly damaging Het
Carf A T 1: 60,141,505 H362L possibly damaging Het
Ccdc171 A C 4: 83,546,895 I37L probably benign Het
Ccdc182 T C 11: 88,294,190 L32P possibly damaging Het
Celsr3 A T 9: 108,834,626 D1678V possibly damaging Het
Col7a1 A T 9: 108,960,997 Y920F unknown Het
Cpsf3 T C 12: 21,313,790 V627A probably benign Het
D7Ertd443e A G 7: 134,270,212 M640T probably damaging Het
Ddi2 T C 4: 141,683,972 D543G probably damaging Het
Dnah9 T C 11: 65,955,297 N2972D probably damaging Het
Dnajc18 T C 18: 35,680,804 D304G probably damaging Het
Epg5 T C 18: 77,983,490 V1232A possibly damaging Het
Ezr T C 17: 6,742,372 T358A possibly damaging Het
Filip1 A G 9: 79,815,846 S1164P probably damaging Het
Gm14085 C T 2: 122,521,652 R324C possibly damaging Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gmip T C 8: 69,814,477 V341A probably benign Het
Gnb3 A C 6: 124,835,636 F286V probably benign Het
Gpatch2 T A 1: 187,225,831 S128T probably benign Het
Gpr87 T C 3: 59,179,392 R231G possibly damaging Het
Hip1r G A 5: 123,998,808 R613Q probably benign Het
Hsd3b7 T C 7: 127,803,034 Y284H possibly damaging Het
Il1rap A T 16: 26,698,875 D275V probably damaging Het
Il4 G T 11: 53,618,538 H23Q possibly damaging Het
Kit A G 5: 75,648,393 Y749C probably damaging Het
Klb A G 5: 65,349,235 K275R probably null Het
Klhl12 G T 1: 134,489,070 R510L probably damaging Het
Lrrc8b A G 5: 105,480,823 Y345C probably damaging Het
Med15 T C 16: 17,680,735 T98A possibly damaging Het
Mmp1a T A 9: 7,475,390 Y387N probably damaging Het
Myrf C A 19: 10,214,191 V928L probably benign Het
Nr1d1 T C 11: 98,771,499 K134E probably damaging Het
Nrxn3 A T 12: 90,283,582 D305V probably damaging Het
Obscn A C 11: 58,998,321 S7542A unknown Het
Olfr1197 T A 2: 88,729,264 I112F probably damaging Het
Pak4 G A 7: 28,565,190 R96C probably damaging Het
Papd5 T G 8: 88,250,788 V406G probably benign Het
Pde6b A T 5: 108,427,847 D691V possibly damaging Het
Pdss2 A G 10: 43,345,605 E171G probably benign Het
Pdzd2 C T 15: 12,387,654 V873I possibly damaging Het
Plb1 A T 5: 32,293,243 D376V probably damaging Het
Plekhg1 T C 10: 3,963,904 Y1209H probably damaging Het
Prickle2 A G 6: 92,416,904 C263R probably damaging Het
Psma2 A T 13: 14,623,605 Y104F probably benign Het
Ptger4 T A 15: 5,242,800 M113L possibly damaging Het
Rgs10 T G 7: 128,404,477 D17A possibly damaging Het
Rpap3 A G 15: 97,694,209 S189P possibly damaging Het
Rsbn1 T C 3: 103,914,872 L102P probably damaging Het
Ryr2 T C 13: 11,595,281 S655G probably benign Het
Samd4b A T 7: 28,407,331 probably null Het
Sema4a C T 3: 88,436,749 D732N probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Sh3gl3 C T 7: 82,284,119 T230I possibly damaging Het
Slc5a1 A T 5: 33,146,953 Q299L probably damaging Het
Ssc5d C A 7: 4,936,607 H681N probably benign Het
Sugp2 T C 8: 70,236,710 S10P possibly damaging Het
Supt5 A G 7: 28,317,214 probably null Het
Syna A G 5: 134,560,089 V2A probably benign Het
Tcp1 T A 17: 12,922,202 Y299* probably null Het
Tenm3 C A 8: 48,276,256 V1572L probably benign Het
Trp53rka A G 2: 165,491,613 S119P probably damaging Het
Ubr4 T A 4: 139,452,563 probably null Het
Uchl4 T A 9: 64,235,475 D79E probably benign Het
Xpnpep1 A G 19: 53,010,133 L228P probably damaging Het
Xrcc4 T G 13: 89,992,579 E170D probably damaging Het
Zfp945 T C 17: 22,851,762 T388A probably damaging Het
Zfp947 G A 17: 22,146,462 A77V probably benign Het
Zkscan5 G A 5: 145,220,205 G433R probably damaging Het
Other mutations in Vmn2r17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Vmn2r17 APN 5 109427992 missense probably benign 0.15
IGL01457:Vmn2r17 APN 5 109453032 missense probably benign 0.00
IGL01527:Vmn2r17 APN 5 109453140 missense probably damaging 1.00
IGL01693:Vmn2r17 APN 5 109452518 missense probably damaging 1.00
IGL01738:Vmn2r17 APN 5 109429498 missense probably damaging 1.00
IGL01767:Vmn2r17 APN 5 109420037 missense probably benign 0.01
IGL01932:Vmn2r17 APN 5 109427050 missense probably benign 0.00
IGL01970:Vmn2r17 APN 5 109427947 missense probably damaging 0.97
IGL02009:Vmn2r17 APN 5 109452848 missense possibly damaging 0.67
IGL02365:Vmn2r17 APN 5 109453309 missense probably damaging 1.00
IGL02385:Vmn2r17 APN 5 109434381 missense probably damaging 1.00
IGL02457:Vmn2r17 APN 5 109453146 missense probably damaging 1.00
IGL02646:Vmn2r17 APN 5 109453080 missense probably damaging 1.00
IGL02741:Vmn2r17 APN 5 109420211 missense probably benign
IGL03213:Vmn2r17 APN 5 109434390 critical splice donor site probably null
IGL03216:Vmn2r17 APN 5 109452890 missense probably damaging 1.00
IGL03342:Vmn2r17 APN 5 109427916 missense probably damaging 1.00
IGL03408:Vmn2r17 APN 5 109429372 splice site probably benign
R0349:Vmn2r17 UTSW 5 109428336 missense probably damaging 1.00
R0418:Vmn2r17 UTSW 5 109452881 missense probably damaging 1.00
R0800:Vmn2r17 UTSW 5 109427326 splice site probably benign
R0836:Vmn2r17 UTSW 5 109427956 missense possibly damaging 0.89
R1715:Vmn2r17 UTSW 5 109428244 missense probably benign 0.00
R1738:Vmn2r17 UTSW 5 109428511 missense probably benign 0.10
R2054:Vmn2r17 UTSW 5 109452486 missense probably damaging 0.98
R2060:Vmn2r17 UTSW 5 109427209 missense probably benign 0.00
R2192:Vmn2r17 UTSW 5 109434278 missense possibly damaging 0.81
R2315:Vmn2r17 UTSW 5 109428031 missense probably damaging 1.00
R2374:Vmn2r17 UTSW 5 109427238 missense probably benign
R3612:Vmn2r17 UTSW 5 109429597 missense probably benign 0.00
R3832:Vmn2r17 UTSW 5 109428396 missense probably damaging 1.00
R4273:Vmn2r17 UTSW 5 109452966 missense probably benign 0.44
R4494:Vmn2r17 UTSW 5 109428469 missense probably damaging 1.00
R4597:Vmn2r17 UTSW 5 109429562 missense probably benign 0.01
R4675:Vmn2r17 UTSW 5 109427183 missense probably benign 0.00
R4701:Vmn2r17 UTSW 5 109427983 missense probably damaging 0.99
R4754:Vmn2r17 UTSW 5 109452849 missense probably damaging 0.99
R4841:Vmn2r17 UTSW 5 109434380 missense probably damaging 1.00
R4842:Vmn2r17 UTSW 5 109434380 missense probably damaging 1.00
R4865:Vmn2r17 UTSW 5 109427119 missense probably damaging 1.00
R4902:Vmn2r17 UTSW 5 109453354 missense probably benign 0.14
R4989:Vmn2r17 UTSW 5 109427873 missense probably benign 0.07
R5101:Vmn2r17 UTSW 5 109428351 missense probably damaging 0.99
R5109:Vmn2r17 UTSW 5 109429476 missense probably benign 0.06
R5123:Vmn2r17 UTSW 5 109427908 missense possibly damaging 0.90
R5474:Vmn2r17 UTSW 5 109434284 missense probably damaging 1.00
R5485:Vmn2r17 UTSW 5 109420106 missense probably benign 0.06
R5611:Vmn2r17 UTSW 5 109428164 missense probably damaging 0.97
R5652:Vmn2r17 UTSW 5 109429564 missense probably benign 0.10
R5717:Vmn2r17 UTSW 5 109427274 missense possibly damaging 0.94
R5735:Vmn2r17 UTSW 5 109452850 missense possibly damaging 0.67
R5766:Vmn2r17 UTSW 5 109427273 missense possibly damaging 0.46
R6645:Vmn2r17 UTSW 5 109428381 missense probably damaging 1.00
R6786:Vmn2r17 UTSW 5 109427829 missense probably benign 0.30
R6821:Vmn2r17 UTSW 5 109429465 missense probably damaging 1.00
R6979:Vmn2r17 UTSW 5 109428399 missense possibly damaging 0.46
R6984:Vmn2r17 UTSW 5 109452667 missense probably benign 0.10
R7269:Vmn2r17 UTSW 5 109428471 missense possibly damaging 0.88
R7509:Vmn2r17 UTSW 5 109427829 missense probably benign 0.30
R7736:Vmn2r17 UTSW 5 109452891 missense probably benign 0.05
R7789:Vmn2r17 UTSW 5 109452965 missense possibly damaging 0.77
R7814:Vmn2r17 UTSW 5 109427873 missense probably benign 0.07
R7847:Vmn2r17 UTSW 5 109420197 missense probably damaging 1.00
R7863:Vmn2r17 UTSW 5 109420169 missense probably benign
R7893:Vmn2r17 UTSW 5 109428078 missense probably benign 0.05
R7930:Vmn2r17 UTSW 5 109420197 missense probably damaging 1.00
R7946:Vmn2r17 UTSW 5 109420169 missense probably benign
R7976:Vmn2r17 UTSW 5 109428078 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACATTTCTCAGACTATGCAGGAGTG -3'
(R):5'- AACTCACTGGTGTCCACAC -3'

Sequencing Primer
(F):5'- CACATTGGAATGGACAGC -3'
(R):5'- TCTCCTATTAAATGTTATCCTTGTGC -3'
Posted On2014-06-23