Mutagenetix > Incidental Mutation

Incidental Mutation 'R1801:Prickle2'

203129

Institutional Source

Beutler Lab

Gene Symbol

Prickle2

Ensembl Gene

ENSMUSG00000030020

Gene Name

prickle planar cell polarity protein 2

Synonyms

6230400G14Rik, mpk2, 6720451F06Rik

MMRRC Submission

039831-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.559) question?

Stock #

R1801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92370908-92706155 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92416904 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 263 (C263R)

Ref Sequence

ENSEMBL: ENSMUSP00000032093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032093] [ENSMUST00000113445] [ENSMUST00000113446] [ENSMUST00000113447]

AlphaFold

Q80Y24

Predicted Effect

probably damaging
Transcript: ENSMUST00000032093
AA Change: C263R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000032093
Gene: ENSMUSG00000030020
AA Change: C263R

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
Pfam:PET	76	176	1.2e-45	PFAM
LIM	185	242	3.05e-10	SMART
LIM	250	302	5.43e-16	SMART
LIM	310	365	2.92e-7	SMART
low complexity region	465	477	N/A	INTRINSIC
low complexity region	534	546	N/A	INTRINSIC
low complexity region	725	753	N/A	INTRINSIC
low complexity region	832	841	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113445
AA Change: C207R

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109072
Gene: ENSMUSG00000030020
AA Change: C207R

Domain	Start	End	E-Value	Type
Pfam:PET	17	122	8.9e-47	PFAM
LIM	129	186	3.05e-10	SMART
LIM	194	246	5.43e-16	SMART
LIM	254	309	2.92e-7	SMART
low complexity region	409	421	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	669	697	N/A	INTRINSIC
low complexity region	776	785	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113446
AA Change: C207R

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109073
Gene: ENSMUSG00000030020
AA Change: C207R

Domain	Start	End	E-Value	Type
Pfam:PET	17	122	8.9e-47	PFAM
LIM	129	186	3.05e-10	SMART
LIM	194	246	5.43e-16	SMART
LIM	254	309	2.92e-7	SMART
low complexity region	409	421	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	669	697	N/A	INTRINSIC
low complexity region	776	785	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113447
AA Change: C207R

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109074
Gene: ENSMUSG00000030020
AA Change: C207R

Domain	Start	End	E-Value	Type
Pfam:PET	17	122	8.9e-47	PFAM
LIM	129	186	3.05e-10	SMART
LIM	194	246	5.43e-16	SMART
LIM	254	309	2.92e-7	SMART
low complexity region	409	421	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	669	697	N/A	INTRINSIC
low complexity region	776	785	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homolog of Drosophila prickle. The exact function of this gene is not known, however, studies in mice suggest that it may be involved in seizure prevention. Mutations in this gene are associated with progressive myoclonic epilepsy type 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive or PTZ-induced seizures. Mice heterozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,067,396	E362G	probably damaging	Het
Abcc5	T	C	16: 20,338,887	M1307V	probably benign	Het
Adamts9	A	G	6: 92,863,376	V1142A	probably benign	Het
Ano10	T	C	9: 122,253,030	N525S	probably damaging	Het
Bpifa2	T	C	2: 154,011,504		probably null	Het
C7	C	T	15: 5,012,021	V468I	possibly damaging	Het
Carf	A	T	1: 60,141,505	H362L	possibly damaging	Het
Ccdc171	A	C	4: 83,546,895	I37L	probably benign	Het
Ccdc182	T	C	11: 88,294,190	L32P	possibly damaging	Het
Celsr3	A	T	9: 108,834,626	D1678V	possibly damaging	Het
Col7a1	A	T	9: 108,960,997	Y920F	unknown	Het
Cpsf3	T	C	12: 21,313,790	V627A	probably benign	Het
D7Ertd443e	A	G	7: 134,270,212	M640T	probably damaging	Het
Ddi2	T	C	4: 141,683,972	D543G	probably damaging	Het
Dnah9	T	C	11: 65,955,297	N2972D	probably damaging	Het
Dnajc18	T	C	18: 35,680,804	D304G	probably damaging	Het
Epg5	T	C	18: 77,983,490	V1232A	possibly damaging	Het
Ezr	T	C	17: 6,742,372	T358A	possibly damaging	Het
Filip1	A	G	9: 79,815,846	S1164P	probably damaging	Het
Gm14085	C	T	2: 122,521,652	R324C	possibly damaging	Het
Gm5346	A	T	8: 43,625,917	C423*	probably null	Het
Gmip	T	C	8: 69,814,477	V341A	probably benign	Het
Gnb3	A	C	6: 124,835,636	F286V	probably benign	Het
Gpatch2	T	A	1: 187,225,831	S128T	probably benign	Het
Gpr87	T	C	3: 59,179,392	R231G	possibly damaging	Het
Hip1r	G	A	5: 123,998,808	R613Q	probably benign	Het
Hsd3b7	T	C	7: 127,803,034	Y284H	possibly damaging	Het
Il1rap	A	T	16: 26,698,875	D275V	probably damaging	Het
Il4	G	T	11: 53,618,538	H23Q	possibly damaging	Het
Kit	A	G	5: 75,648,393	Y749C	probably damaging	Het
Klb	A	G	5: 65,349,235	K275R	probably null	Het
Klhl12	G	T	1: 134,489,070	R510L	probably damaging	Het
Lrrc8b	A	G	5: 105,480,823	Y345C	probably damaging	Het
Med15	T	C	16: 17,680,735	T98A	possibly damaging	Het
Mmp1a	T	A	9: 7,475,390	Y387N	probably damaging	Het
Myrf	C	A	19: 10,214,191	V928L	probably benign	Het
Nr1d1	T	C	11: 98,771,499	K134E	probably damaging	Het
Nrxn3	A	T	12: 90,283,582	D305V	probably damaging	Het
Obscn	A	C	11: 58,998,321	S7542A	unknown	Het
Olfr1197	T	A	2: 88,729,264	I112F	probably damaging	Het
Pak4	G	A	7: 28,565,190	R96C	probably damaging	Het
Papd5	T	G	8: 88,250,788	V406G	probably benign	Het
Pde6b	A	T	5: 108,427,847	D691V	possibly damaging	Het
Pdss2	A	G	10: 43,345,605	E171G	probably benign	Het
Pdzd2	C	T	15: 12,387,654	V873I	possibly damaging	Het
Plb1	A	T	5: 32,293,243	D376V	probably damaging	Het
Plekhg1	T	C	10: 3,963,904	Y1209H	probably damaging	Het
Psma2	A	T	13: 14,623,605	Y104F	probably benign	Het
Ptger4	T	A	15: 5,242,800	M113L	possibly damaging	Het
Rgs10	T	G	7: 128,404,477	D17A	possibly damaging	Het
Rpap3	A	G	15: 97,694,209	S189P	possibly damaging	Het
Rsbn1	T	C	3: 103,914,872	L102P	probably damaging	Het
Ryr2	T	C	13: 11,595,281	S655G	probably benign	Het
Samd4b	A	T	7: 28,407,331		probably null	Het
Sema4a	C	T	3: 88,436,749	D732N	probably benign	Het
Sh3bp5l	A	G	11: 58,346,351	D378G	probably benign	Het
Sh3gl3	C	T	7: 82,284,119	T230I	possibly damaging	Het
Slc5a1	A	T	5: 33,146,953	Q299L	probably damaging	Het
Ssc5d	C	A	7: 4,936,607	H681N	probably benign	Het
Sugp2	T	C	8: 70,236,710	S10P	possibly damaging	Het
Supt5	A	G	7: 28,317,214		probably null	Het
Syna	A	G	5: 134,560,089	V2A	probably benign	Het
Tcp1	T	A	17: 12,922,202	Y299*	probably null	Het
Tenm3	C	A	8: 48,276,256	V1572L	probably benign	Het
Trp53rka	A	G	2: 165,491,613	S119P	probably damaging	Het
Ubr4	T	A	4: 139,452,563		probably null	Het
Uchl4	T	A	9: 64,235,475	D79E	probably benign	Het
Vmn2r17	C	A	5: 109,428,478	T405K	probably damaging	Het
Xpnpep1	A	G	19: 53,010,133	L228P	probably damaging	Het
Xrcc4	T	G	13: 89,992,579	E170D	probably damaging	Het
Zfp945	T	C	17: 22,851,762	T388A	probably damaging	Het
Zfp947	G	A	17: 22,146,462	A77V	probably benign	Het
Zkscan5	G	A	5: 145,220,205	G433R	probably damaging	Het

Other mutations in Prickle2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02962:Prickle2	APN	6	92376422	missense	probably benign	0.00
R0028:Prickle2	UTSW	6	92422342	missense	probably benign	0.12
R0122:Prickle2	UTSW	6	92411345	nonsense	probably null
R0555:Prickle2	UTSW	6	92458565	missense	probably benign	0.02
R0940:Prickle2	UTSW	6	92411003	missense	probably benign	0.02
R1394:Prickle2	UTSW	6	92376382	missense	possibly damaging	0.87
R1470:Prickle2	UTSW	6	92458602	missense	probably damaging	0.96
R1470:Prickle2	UTSW	6	92458602	missense	probably damaging	0.96
R1599:Prickle2	UTSW	6	92410874	missense	probably benign
R1745:Prickle2	UTSW	6	92376593	missense	probably damaging	1.00
R1985:Prickle2	UTSW	6	92411452	missense	probably damaging	1.00
R2085:Prickle2	UTSW	6	92376364	missense	probably damaging	0.96
R2147:Prickle2	UTSW	6	92425671	missense	probably damaging	0.99
R2148:Prickle2	UTSW	6	92425671	missense	probably damaging	0.99
R2571:Prickle2	UTSW	6	92705400	missense	probably benign	0.09
R3547:Prickle2	UTSW	6	92411137	missense	probably damaging	1.00
R4356:Prickle2	UTSW	6	92411509	missense	probably damaging	1.00
R4569:Prickle2	UTSW	6	92422342	missense	probably benign	0.12
R4896:Prickle2	UTSW	6	92416755	missense	probably benign	0.26
R5004:Prickle2	UTSW	6	92416755	missense	probably benign	0.26
R5045:Prickle2	UTSW	6	92376394	missense	probably damaging	0.96
R5219:Prickle2	UTSW	6	92376530	missense	probably benign
R5247:Prickle2	UTSW	6	92375969	missense	probably damaging	1.00
R5280:Prickle2	UTSW	6	92376210	missense	probably damaging	1.00
R5334:Prickle2	UTSW	6	92425684	missense	probably damaging	1.00
R5780:Prickle2	UTSW	6	92458612	missense	probably benign	0.06
R5960:Prickle2	UTSW	6	92376305	missense	probably benign	0.08
R6084:Prickle2	UTSW	6	92416848	nonsense	probably null
R6362:Prickle2	UTSW	6	92458615	missense	possibly damaging	0.77
R6368:Prickle2	UTSW	6	92420237	missense	probably damaging	1.00
R6852:Prickle2	UTSW	6	92376544	missense	probably benign
R7041:Prickle2	UTSW	6	92376305	missense	probably benign	0.08
R7203:Prickle2	UTSW	6	92410978	missense	possibly damaging	0.61
R7352:Prickle2	UTSW	6	92410890	missense	probably benign	0.00
R7405:Prickle2	UTSW	6	92458543	missense	probably damaging	0.96
R7510:Prickle2	UTSW	6	92376470	missense	possibly damaging	0.58
R7562:Prickle2	UTSW	6	92375948	makesense	probably null
R7578:Prickle2	UTSW	6	92411290	missense	probably benign	0.32
R7614:Prickle2	UTSW	6	92425650	missense	possibly damaging	0.46
R7732:Prickle2	UTSW	6	92411224	missense	probably damaging	1.00
R7948:Prickle2	UTSW	6	92416922	missense	possibly damaging	0.84
R7984:Prickle2	UTSW	6	92410874	missense	probably benign
R8350:Prickle2	UTSW	6	92376502	missense	probably benign
R8404:Prickle2	UTSW	6	92420321	missense	probably damaging	0.96
R8988:Prickle2	UTSW	6	92458639	missense	possibly damaging	0.92
R9184:Prickle2	UTSW	6	92411524	missense	possibly damaging	0.46
R9348:Prickle2	UTSW	6	92420262	missense	probably benign	0.00
R9755:Prickle2	UTSW	6	92422338	missense	probably damaging	1.00
X0020:Prickle2	UTSW	6	92416853	missense	probably damaging	0.98
X0026:Prickle2	UTSW	6	92411426	nonsense	probably null
X0066:Prickle2	UTSW	6	92376433	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTACCTATATGTTGGGCACAGG -3'
(R):5'- ACCATTAGCTCTCCACTAAAATGTG -3'

Sequencing Primer
(F):5'- CCTATATGTTGGGCACAGGTATCAC -3'
(R):5'- GGAACCAAATTAATTGTGCTTCAGG -3'

Posted On

2014-06-23