Incidental Mutation 'R1801:Gnb3'
ID203131
Institutional Source Beutler Lab
Gene Symbol Gnb3
Ensembl Gene ENSMUSG00000023439
Gene Nameguanine nucleotide binding protein (G protein), beta 3
Synonyms
MMRRC Submission 039831-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1801 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124834240-124840275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 124835636 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 286 (F286V)
Ref Sequence ENSEMBL: ENSMUSP00000024206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024206] [ENSMUST00000024270] [ENSMUST00000131847] [ENSMUST00000150120] [ENSMUST00000151674]
Predicted Effect probably benign
Transcript: ENSMUST00000024206
AA Change: F286V

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000024206
Gene: ENSMUSG00000023439
AA Change: F286V

DomainStartEndE-ValueType
WD40 44 83 4.91e-8 SMART
WD40 86 125 1.61e-3 SMART
WD40 132 170 5.1e-6 SMART
WD40 173 212 3.99e-8 SMART
WD40 215 254 2.67e-9 SMART
WD40 263 298 2e-1 SMART
WD40 301 340 3.87e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129251
Predicted Effect probably benign
Transcript: ENSMUST00000131847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140233
Predicted Effect probably benign
Transcript: ENSMUST00000150120
Predicted Effect probably benign
Transcript: ENSMUST00000151674
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit which belongs to the WD repeat G protein beta family. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal light ON response and synaptic maintenance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,396 E362G probably damaging Het
Abcc5 T C 16: 20,338,887 M1307V probably benign Het
Adamts9 A G 6: 92,863,376 V1142A probably benign Het
Ano10 T C 9: 122,253,030 N525S probably damaging Het
Bpifa2 T C 2: 154,011,504 probably null Het
C7 C T 15: 5,012,021 V468I possibly damaging Het
Carf A T 1: 60,141,505 H362L possibly damaging Het
Ccdc171 A C 4: 83,546,895 I37L probably benign Het
Ccdc182 T C 11: 88,294,190 L32P possibly damaging Het
Celsr3 A T 9: 108,834,626 D1678V possibly damaging Het
Col7a1 A T 9: 108,960,997 Y920F unknown Het
Cpsf3 T C 12: 21,313,790 V627A probably benign Het
D7Ertd443e A G 7: 134,270,212 M640T probably damaging Het
Ddi2 T C 4: 141,683,972 D543G probably damaging Het
Dnah9 T C 11: 65,955,297 N2972D probably damaging Het
Dnajc18 T C 18: 35,680,804 D304G probably damaging Het
Epg5 T C 18: 77,983,490 V1232A possibly damaging Het
Ezr T C 17: 6,742,372 T358A possibly damaging Het
Filip1 A G 9: 79,815,846 S1164P probably damaging Het
Gm14085 C T 2: 122,521,652 R324C possibly damaging Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gmip T C 8: 69,814,477 V341A probably benign Het
Gpatch2 T A 1: 187,225,831 S128T probably benign Het
Gpr87 T C 3: 59,179,392 R231G possibly damaging Het
Hip1r G A 5: 123,998,808 R613Q probably benign Het
Hsd3b7 T C 7: 127,803,034 Y284H possibly damaging Het
Il1rap A T 16: 26,698,875 D275V probably damaging Het
Il4 G T 11: 53,618,538 H23Q possibly damaging Het
Kit A G 5: 75,648,393 Y749C probably damaging Het
Klb A G 5: 65,349,235 K275R probably null Het
Klhl12 G T 1: 134,489,070 R510L probably damaging Het
Lrrc8b A G 5: 105,480,823 Y345C probably damaging Het
Med15 T C 16: 17,680,735 T98A possibly damaging Het
Mmp1a T A 9: 7,475,390 Y387N probably damaging Het
Myrf C A 19: 10,214,191 V928L probably benign Het
Nr1d1 T C 11: 98,771,499 K134E probably damaging Het
Nrxn3 A T 12: 90,283,582 D305V probably damaging Het
Obscn A C 11: 58,998,321 S7542A unknown Het
Olfr1197 T A 2: 88,729,264 I112F probably damaging Het
Pak4 G A 7: 28,565,190 R96C probably damaging Het
Papd5 T G 8: 88,250,788 V406G probably benign Het
Pde6b A T 5: 108,427,847 D691V possibly damaging Het
Pdss2 A G 10: 43,345,605 E171G probably benign Het
Pdzd2 C T 15: 12,387,654 V873I possibly damaging Het
Plb1 A T 5: 32,293,243 D376V probably damaging Het
Plekhg1 T C 10: 3,963,904 Y1209H probably damaging Het
Prickle2 A G 6: 92,416,904 C263R probably damaging Het
Psma2 A T 13: 14,623,605 Y104F probably benign Het
Ptger4 T A 15: 5,242,800 M113L possibly damaging Het
Rgs10 T G 7: 128,404,477 D17A possibly damaging Het
Rpap3 A G 15: 97,694,209 S189P possibly damaging Het
Rsbn1 T C 3: 103,914,872 L102P probably damaging Het
Ryr2 T C 13: 11,595,281 S655G probably benign Het
Samd4b A T 7: 28,407,331 probably null Het
Sema4a C T 3: 88,436,749 D732N probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Sh3gl3 C T 7: 82,284,119 T230I possibly damaging Het
Slc5a1 A T 5: 33,146,953 Q299L probably damaging Het
Ssc5d C A 7: 4,936,607 H681N probably benign Het
Sugp2 T C 8: 70,236,710 S10P possibly damaging Het
Supt5 A G 7: 28,317,214 probably null Het
Syna A G 5: 134,560,089 V2A probably benign Het
Tcp1 T A 17: 12,922,202 Y299* probably null Het
Tenm3 C A 8: 48,276,256 V1572L probably benign Het
Trp53rka A G 2: 165,491,613 S119P probably damaging Het
Ubr4 T A 4: 139,452,563 probably null Het
Uchl4 T A 9: 64,235,475 D79E probably benign Het
Vmn2r17 C A 5: 109,428,478 T405K probably damaging Het
Xpnpep1 A G 19: 53,010,133 L228P probably damaging Het
Xrcc4 T G 13: 89,992,579 E170D probably damaging Het
Zfp945 T C 17: 22,851,762 T388A probably damaging Het
Zfp947 G A 17: 22,146,462 A77V probably benign Het
Zkscan5 G A 5: 145,220,205 G433R probably damaging Het
Other mutations in Gnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Gnb3 APN 6 124837255 missense probably damaging 0.98
IGL01707:Gnb3 APN 6 124839689 missense possibly damaging 0.56
IGL02412:Gnb3 APN 6 124837462 missense probably benign 0.23
IGL02606:Gnb3 APN 6 124837415 missense probably benign 0.01
IGL02627:Gnb3 APN 6 124834715 missense probably damaging 0.98
IGL02669:Gnb3 APN 6 124837725 missense probably benign 0.17
R0006:Gnb3 UTSW 6 124835804 unclassified probably benign
R0026:Gnb3 UTSW 6 124837417 missense probably benign 0.00
R0445:Gnb3 UTSW 6 124837255 missense possibly damaging 0.92
R0538:Gnb3 UTSW 6 124835696 nonsense probably null
R4074:Gnb3 UTSW 6 124836979 missense probably benign
R6715:Gnb3 UTSW 6 124837728 missense possibly damaging 0.94
R7146:Gnb3 UTSW 6 124836924 critical splice donor site probably null
R7689:Gnb3 UTSW 6 124837220 missense possibly damaging 0.82
R7884:Gnb3 UTSW 6 124837092 missense probably benign 0.00
R7967:Gnb3 UTSW 6 124837092 missense probably benign 0.00
X0017:Gnb3 UTSW 6 124837068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGGTGTCGGTTCCCAAG -3'
(R):5'- AAATGGCTTATACACTCTTCCCCAG -3'

Sequencing Primer
(F):5'- AAGGCTCCTGTCAGGCAACAG -3'
(R):5'- GAGCCCTGACCTCTTCTTAACTG -3'
Posted On2014-06-23