Mutagenetix > Incidental Mutation

Incidental Mutation 'R1801:Ssc5d'

203132

Institutional Source

Beutler Lab

Gene Symbol

Ssc5d

Ensembl Gene

ENSMUSG00000035279

Gene Name

scavenger receptor cysteine rich family, 5 domains

Synonyms

s5d-srcrb, A430110N23Rik

MMRRC Submission

039831-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4925785-4944826 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 4936607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 681 (H681N)

Ref Sequence

ENSEMBL: ENSMUSP00000052126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]

AlphaFold

Q8BV57

Predicted Effect

probably benign
Transcript: ENSMUST00000057612
AA Change: H681N

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: H681N

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SR	20	120	4.44e-49	SMART
low complexity region	141	155	N/A	INTRINSIC
low complexity region	167	182	N/A	INTRINSIC
SR	199	299	2.36e-53	SMART
SR	305	405	8.22e-53	SMART
low complexity region	437	462	N/A	INTRINSIC
SR	464	565	1.11e-49	SMART
low complexity region	741	755	N/A	INTRINSIC
SR	758	858	3.93e-50	SMART
low complexity region	936	957	N/A	INTRINSIC
low complexity region	981	1004	N/A	INTRINSIC
low complexity region	1018	1035	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1357	1364	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207310

Predicted Effect

probably benign
Transcript: ENSMUST00000208109

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,067,396	E362G	probably damaging	Het
Abcc5	T	C	16: 20,338,887	M1307V	probably benign	Het
Adamts9	A	G	6: 92,863,376	V1142A	probably benign	Het
Ano10	T	C	9: 122,253,030	N525S	probably damaging	Het
Bpifa2	T	C	2: 154,011,504		probably null	Het
C7	C	T	15: 5,012,021	V468I	possibly damaging	Het
Carf	A	T	1: 60,141,505	H362L	possibly damaging	Het
Ccdc171	A	C	4: 83,546,895	I37L	probably benign	Het
Ccdc182	T	C	11: 88,294,190	L32P	possibly damaging	Het
Celsr3	A	T	9: 108,834,626	D1678V	possibly damaging	Het
Col7a1	A	T	9: 108,960,997	Y920F	unknown	Het
Cpsf3	T	C	12: 21,313,790	V627A	probably benign	Het
D7Ertd443e	A	G	7: 134,270,212	M640T	probably damaging	Het
Ddi2	T	C	4: 141,683,972	D543G	probably damaging	Het
Dnah9	T	C	11: 65,955,297	N2972D	probably damaging	Het
Dnajc18	T	C	18: 35,680,804	D304G	probably damaging	Het
Epg5	T	C	18: 77,983,490	V1232A	possibly damaging	Het
Ezr	T	C	17: 6,742,372	T358A	possibly damaging	Het
Filip1	A	G	9: 79,815,846	S1164P	probably damaging	Het
Gm14085	C	T	2: 122,521,652	R324C	possibly damaging	Het
Gm5346	A	T	8: 43,625,917	C423*	probably null	Het
Gmip	T	C	8: 69,814,477	V341A	probably benign	Het
Gnb3	A	C	6: 124,835,636	F286V	probably benign	Het
Gpatch2	T	A	1: 187,225,831	S128T	probably benign	Het
Gpr87	T	C	3: 59,179,392	R231G	possibly damaging	Het
Hip1r	G	A	5: 123,998,808	R613Q	probably benign	Het
Hsd3b7	T	C	7: 127,803,034	Y284H	possibly damaging	Het
Il1rap	A	T	16: 26,698,875	D275V	probably damaging	Het
Il4	G	T	11: 53,618,538	H23Q	possibly damaging	Het
Kit	A	G	5: 75,648,393	Y749C	probably damaging	Het
Klb	A	G	5: 65,349,235	K275R	probably null	Het
Klhl12	G	T	1: 134,489,070	R510L	probably damaging	Het
Lrrc8b	A	G	5: 105,480,823	Y345C	probably damaging	Het
Med15	T	C	16: 17,680,735	T98A	possibly damaging	Het
Mmp1a	T	A	9: 7,475,390	Y387N	probably damaging	Het
Myrf	C	A	19: 10,214,191	V928L	probably benign	Het
Nr1d1	T	C	11: 98,771,499	K134E	probably damaging	Het
Nrxn3	A	T	12: 90,283,582	D305V	probably damaging	Het
Obscn	A	C	11: 58,998,321	S7542A	unknown	Het
Olfr1197	T	A	2: 88,729,264	I112F	probably damaging	Het
Pak4	G	A	7: 28,565,190	R96C	probably damaging	Het
Papd5	T	G	8: 88,250,788	V406G	probably benign	Het
Pde6b	A	T	5: 108,427,847	D691V	possibly damaging	Het
Pdss2	A	G	10: 43,345,605	E171G	probably benign	Het
Pdzd2	C	T	15: 12,387,654	V873I	possibly damaging	Het
Plb1	A	T	5: 32,293,243	D376V	probably damaging	Het
Plekhg1	T	C	10: 3,963,904	Y1209H	probably damaging	Het
Prickle2	A	G	6: 92,416,904	C263R	probably damaging	Het
Psma2	A	T	13: 14,623,605	Y104F	probably benign	Het
Ptger4	T	A	15: 5,242,800	M113L	possibly damaging	Het
Rgs10	T	G	7: 128,404,477	D17A	possibly damaging	Het
Rpap3	A	G	15: 97,694,209	S189P	possibly damaging	Het
Rsbn1	T	C	3: 103,914,872	L102P	probably damaging	Het
Ryr2	T	C	13: 11,595,281	S655G	probably benign	Het
Samd4b	A	T	7: 28,407,331		probably null	Het
Sema4a	C	T	3: 88,436,749	D732N	probably benign	Het
Sh3bp5l	A	G	11: 58,346,351	D378G	probably benign	Het
Sh3gl3	C	T	7: 82,284,119	T230I	possibly damaging	Het
Slc5a1	A	T	5: 33,146,953	Q299L	probably damaging	Het
Sugp2	T	C	8: 70,236,710	S10P	possibly damaging	Het
Supt5	A	G	7: 28,317,214		probably null	Het
Syna	A	G	5: 134,560,089	V2A	probably benign	Het
Tcp1	T	A	17: 12,922,202	Y299*	probably null	Het
Tenm3	C	A	8: 48,276,256	V1572L	probably benign	Het
Trp53rka	A	G	2: 165,491,613	S119P	probably damaging	Het
Ubr4	T	A	4: 139,452,563		probably null	Het
Uchl4	T	A	9: 64,235,475	D79E	probably benign	Het
Vmn2r17	C	A	5: 109,428,478	T405K	probably damaging	Het
Xpnpep1	A	G	19: 53,010,133	L228P	probably damaging	Het
Xrcc4	T	G	13: 89,992,579	E170D	probably damaging	Het
Zfp945	T	C	17: 22,851,762	T388A	probably damaging	Het
Zfp947	G	A	17: 22,146,462	A77V	probably benign	Het
Zkscan5	G	A	5: 145,220,205	G433R	probably damaging	Het

Other mutations in Ssc5d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Ssc5d	APN	7	4944481	missense	possibly damaging	0.63
IGL00939:Ssc5d	APN	7	4936281	missense	possibly damaging	0.89
IGL01109:Ssc5d	APN	7	4937112	nonsense	probably null
IGL01409:Ssc5d	APN	7	4942809	missense	probably benign	0.16
IGL01880:Ssc5d	APN	7	4933219	missense	probably damaging	1.00
IGL02013:Ssc5d	APN	7	4943836	missense	probably benign	0.00
IGL02227:Ssc5d	APN	7	4933454	critical splice donor site	probably null
IGL02963:Ssc5d	APN	7	4944327	missense	probably benign	0.02
D4043:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
D4216:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
R0104:Ssc5d	UTSW	7	4936286	missense	probably benign	0.41
R0115:Ssc5d	UTSW	7	4927881	unclassified	probably benign
R0201:Ssc5d	UTSW	7	4944663	missense	probably benign
R0365:Ssc5d	UTSW	7	4928467	nonsense	probably null
R0485:Ssc5d	UTSW	7	4937471	missense	probably damaging	0.99
R0967:Ssc5d	UTSW	7	4944343	nonsense	probably null
R1607:Ssc5d	UTSW	7	4944043	missense	probably benign	0.25
R1639:Ssc5d	UTSW	7	4928417	missense	probably damaging	1.00
R1867:Ssc5d	UTSW	7	4928507	missense	probably damaging	1.00
R1999:Ssc5d	UTSW	7	4942714	missense	possibly damaging	0.86
R2007:Ssc5d	UTSW	7	4928629	missense	probably damaging	1.00
R2084:Ssc5d	UTSW	7	4937012	missense	probably benign	0.01
R2234:Ssc5d	UTSW	7	4943850	missense	probably benign
R2259:Ssc5d	UTSW	7	4943916	missense	probably benign	0.01
R2567:Ssc5d	UTSW	7	4936335	missense	probably damaging	1.00
R2879:Ssc5d	UTSW	7	4936907	critical splice acceptor site	probably null
R3782:Ssc5d	UTSW	7	4942791	missense	probably benign	0.00
R3875:Ssc5d	UTSW	7	4927262	missense	probably damaging	1.00
R4322:Ssc5d	UTSW	7	4928450	missense	probably damaging	1.00
R4331:Ssc5d	UTSW	7	4942726	missense	probably benign	0.00
R4334:Ssc5d	UTSW	7	4943664	missense	probably benign
R4430:Ssc5d	UTSW	7	4943664	missense	probably benign
R4619:Ssc5d	UTSW	7	4929525	missense	probably damaging	1.00
R4794:Ssc5d	UTSW	7	4943745	missense	probably benign
R5106:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R5174:Ssc5d	UTSW	7	4927971	missense	possibly damaging	0.83
R5553:Ssc5d	UTSW	7	4936290	missense	probably damaging	1.00
R5649:Ssc5d	UTSW	7	4926518	critical splice donor site	probably null
R5786:Ssc5d	UTSW	7	4936818	missense	probably benign	0.00
R6059:Ssc5d	UTSW	7	4942744	missense	possibly damaging	0.86
R6163:Ssc5d	UTSW	7	4927254	missense	probably damaging	1.00
R6332:Ssc5d	UTSW	7	4937522	missense	probably damaging	1.00
R6341:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R6613:Ssc5d	UTSW	7	4933293	missense	possibly damaging	0.82
R7180:Ssc5d	UTSW	7	4936601	missense	probably benign	0.17
R7576:Ssc5d	UTSW	7	4928573	missense	probably damaging	1.00
R7602:Ssc5d	UTSW	7	4942746	missense	possibly damaging	0.95
R7609:Ssc5d	UTSW	7	4927576	missense	possibly damaging	0.56
R7691:Ssc5d	UTSW	7	4944169	missense	probably benign	0.29
R7759:Ssc5d	UTSW	7	4937530	nonsense	probably null
R8480:Ssc5d	UTSW	7	4936329	missense	probably damaging	1.00
R9029:Ssc5d	UTSW	7	4927920	missense	probably damaging	0.97
R9163:Ssc5d	UTSW	7	4933433	missense	probably damaging	1.00
R9178:Ssc5d	UTSW	7	4927059	missense	probably damaging	1.00
R9181:Ssc5d	UTSW	7	4942815	missense	possibly damaging	0.86
R9382:Ssc5d	UTSW	7	4927284	critical splice donor site	probably null
R9489:Ssc5d	UTSW	7	4937600	missense	probably benign	0.02
R9626:Ssc5d	UTSW	7	4943569	missense	probably benign
R9630:Ssc5d	UTSW	7	4936427	missense	probably damaging	1.00
R9776:Ssc5d	UTSW	7	4929368	missense	probably benign	0.07
X0063:Ssc5d	UTSW	7	4936287	missense	probably damaging	1.00
Z1088:Ssc5d	UTSW	7	4928434	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCAGTGTGCCACAGAAACC -3'
(R):5'- CTTGGGATGATTCCAGAGAGCC -3'

Sequencing Primer
(F):5'- AGGTTCCAGGGAAAGCTCC -3'
(R):5'- ATGATTCCAGAGAGCCTTCGG -3'

Posted On

2014-06-23