Incidental Mutation 'R1801:Gmip'
ID 203142
Institutional Source Beutler Lab
Gene Symbol Gmip
Ensembl Gene ENSMUSG00000036246
Gene Name Gem-interacting protein
Synonyms 5031419I10Rik
MMRRC Submission 039831-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R1801 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 70261329-70274520 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70267127 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 341 (V341A)
Ref Sequence ENSEMBL: ENSMUSP00000116542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036074] [ENSMUST00000123453]
AlphaFold Q6PGG2
Predicted Effect probably benign
Transcript: ENSMUST00000036074
AA Change: V341A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045676
Gene: ENSMUSG00000036246
AA Change: V341A

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-149 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Blast:RhoGAP 824 971 1e-53 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123453
AA Change: V341A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116542
Gene: ENSMUSG00000036246
AA Change: V341A

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-150 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138269
Predicted Effect probably benign
Transcript: ENSMUST00000142659
SMART Domains Protein: ENSMUSP00000114525
Gene: ENSMUSG00000036246

DomainStartEndE-ValueType
Blast:RhoGAP 2 25 1e-7 BLAST
SCOP:d1f7ca_ 3 32 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156620
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARHGAP family of Rho/Rac/Cdc42-like GTPase activating proteins. The encoded protein interacts with the Ras-related protein Gem through its N-terminal domain. Separately, it interacts with RhoA through a RhoGAP domain, and stimulates RhoA-dependent GTPase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,903,230 (GRCm39) E362G probably damaging Het
Abcc5 T C 16: 20,157,637 (GRCm39) M1307V probably benign Het
Adam34l A T 8: 44,078,954 (GRCm39) C423* probably null Het
Adamts9 A G 6: 92,840,357 (GRCm39) V1142A probably benign Het
Ano10 T C 9: 122,082,096 (GRCm39) N525S probably damaging Het
Bpifa2 T C 2: 153,853,424 (GRCm39) probably null Het
C7 C T 15: 5,041,503 (GRCm39) V468I possibly damaging Het
Carf A T 1: 60,180,664 (GRCm39) H362L possibly damaging Het
Ccdc171 A C 4: 83,465,132 (GRCm39) I37L probably benign Het
Ccdc182 T C 11: 88,185,016 (GRCm39) L32P possibly damaging Het
Celsr3 A T 9: 108,711,825 (GRCm39) D1678V possibly damaging Het
Col7a1 A T 9: 108,790,065 (GRCm39) Y920F unknown Het
Cpsf3 T C 12: 21,363,791 (GRCm39) V627A probably benign Het
D7Ertd443e A G 7: 133,871,941 (GRCm39) M640T probably damaging Het
Ddi2 T C 4: 141,411,283 (GRCm39) D543G probably damaging Het
Dnah9 T C 11: 65,846,123 (GRCm39) N2972D probably damaging Het
Dnajc18 T C 18: 35,813,857 (GRCm39) D304G probably damaging Het
Epg5 T C 18: 78,026,705 (GRCm39) V1232A possibly damaging Het
Ezr T C 17: 7,009,771 (GRCm39) T358A possibly damaging Het
Filip1 A G 9: 79,723,128 (GRCm39) S1164P probably damaging Het
Gnb3 A C 6: 124,812,599 (GRCm39) F286V probably benign Het
Gpatch2 T A 1: 186,958,028 (GRCm39) S128T probably benign Het
Gpr87 T C 3: 59,086,813 (GRCm39) R231G possibly damaging Het
Hip1r G A 5: 124,136,871 (GRCm39) R613Q probably benign Het
Hsd3b7 T C 7: 127,402,206 (GRCm39) Y284H possibly damaging Het
Il1rap A T 16: 26,517,625 (GRCm39) D275V probably damaging Het
Il4 G T 11: 53,509,365 (GRCm39) H23Q possibly damaging Het
Kit A G 5: 75,809,053 (GRCm39) Y749C probably damaging Het
Klb A G 5: 65,506,578 (GRCm39) K275R probably null Het
Klhl12 G T 1: 134,416,808 (GRCm39) R510L probably damaging Het
Lrrc8b A G 5: 105,628,689 (GRCm39) Y345C probably damaging Het
Med15 T C 16: 17,498,599 (GRCm39) T98A possibly damaging Het
Mmp1a T A 9: 7,475,391 (GRCm39) Y387N probably damaging Het
Myrf C A 19: 10,191,555 (GRCm39) V928L probably benign Het
Nr1d1 T C 11: 98,662,325 (GRCm39) K134E probably damaging Het
Nrxn3 A T 12: 90,250,356 (GRCm39) D305V probably damaging Het
Obscn A C 11: 58,889,147 (GRCm39) S7542A unknown Het
Or4a27 T A 2: 88,559,608 (GRCm39) I112F probably damaging Het
Pak4 G A 7: 28,264,615 (GRCm39) R96C probably damaging Het
Pde6b A T 5: 108,575,713 (GRCm39) D691V possibly damaging Het
Pdss2 A G 10: 43,221,601 (GRCm39) E171G probably benign Het
Pdzd2 C T 15: 12,387,740 (GRCm39) V873I possibly damaging Het
Plb1 A T 5: 32,450,587 (GRCm39) D376V probably damaging Het
Plekhg1 T C 10: 3,913,904 (GRCm39) Y1209H probably damaging Het
Prickle2 A G 6: 92,393,885 (GRCm39) C263R probably damaging Het
Psma2 A T 13: 14,798,190 (GRCm39) Y104F probably benign Het
Ptger4 T A 15: 5,272,281 (GRCm39) M113L possibly damaging Het
Rgs10 T G 7: 128,006,201 (GRCm39) D17A possibly damaging Het
Rpap3 A G 15: 97,592,090 (GRCm39) S189P possibly damaging Het
Rsbn1 T C 3: 103,822,188 (GRCm39) L102P probably damaging Het
Ryr2 T C 13: 11,610,167 (GRCm39) S655G probably benign Het
Samd4b A T 7: 28,106,756 (GRCm39) probably null Het
Sema4a C T 3: 88,344,056 (GRCm39) D732N probably benign Het
Sh3bp5l A G 11: 58,237,177 (GRCm39) D378G probably benign Het
Sh3gl3 C T 7: 81,933,327 (GRCm39) T230I possibly damaging Het
Slc28a2b C T 2: 122,352,133 (GRCm39) R324C possibly damaging Het
Slc5a1 A T 5: 33,304,297 (GRCm39) Q299L probably damaging Het
Ssc5d C A 7: 4,939,606 (GRCm39) H681N probably benign Het
Sugp2 T C 8: 70,689,360 (GRCm39) S10P possibly damaging Het
Supt5 A G 7: 28,016,639 (GRCm39) probably null Het
Syna A G 5: 134,588,943 (GRCm39) V2A probably benign Het
Tcp1 T A 17: 13,141,089 (GRCm39) Y299* probably null Het
Tenm3 C A 8: 48,729,291 (GRCm39) V1572L probably benign Het
Tent4b T G 8: 88,977,416 (GRCm39) V406G probably benign Het
Trp53rka A G 2: 165,333,533 (GRCm39) S119P probably damaging Het
Ubr4 T A 4: 139,179,874 (GRCm39) probably null Het
Uchl4 T A 9: 64,142,757 (GRCm39) D79E probably benign Het
Vmn2r17 C A 5: 109,576,344 (GRCm39) T405K probably damaging Het
Xpnpep1 A G 19: 52,998,564 (GRCm39) L228P probably damaging Het
Xrcc4 T G 13: 90,140,698 (GRCm39) E170D probably damaging Het
Zfp945 T C 17: 23,070,736 (GRCm39) T388A probably damaging Het
Zfp947 G A 17: 22,365,443 (GRCm39) A77V probably benign Het
Zkscan5 G A 5: 145,157,015 (GRCm39) G433R probably damaging Het
Other mutations in Gmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Gmip APN 8 70,269,661 (GRCm39) nonsense probably null
IGL02529:Gmip APN 8 70,269,439 (GRCm39) missense probably damaging 0.99
IGL03185:Gmip APN 8 70,262,433 (GRCm39) missense probably benign 0.02
IGL03328:Gmip APN 8 70,264,261 (GRCm39) missense possibly damaging 0.79
microdot UTSW 8 70,266,785 (GRCm39) missense probably damaging 1.00
minnox UTSW 8 70,270,452 (GRCm39) missense probably benign 0.02
puncta UTSW 8 70,268,736 (GRCm39) missense possibly damaging 0.50
R0110:Gmip UTSW 8 70,268,259 (GRCm39) unclassified probably benign
R0329:Gmip UTSW 8 70,263,468 (GRCm39) missense probably benign 0.06
R0330:Gmip UTSW 8 70,263,468 (GRCm39) missense probably benign 0.06
R0510:Gmip UTSW 8 70,268,259 (GRCm39) unclassified probably benign
R0638:Gmip UTSW 8 70,264,095 (GRCm39) splice site probably benign
R1692:Gmip UTSW 8 70,266,553 (GRCm39) missense probably benign
R1721:Gmip UTSW 8 70,263,882 (GRCm39) missense probably damaging 0.96
R1755:Gmip UTSW 8 70,266,774 (GRCm39) missense probably damaging 1.00
R1894:Gmip UTSW 8 70,273,622 (GRCm39) missense probably damaging 1.00
R1926:Gmip UTSW 8 70,268,170 (GRCm39) missense probably benign 0.41
R2005:Gmip UTSW 8 70,266,693 (GRCm39) missense probably benign
R4280:Gmip UTSW 8 70,266,251 (GRCm39) unclassified probably benign
R4281:Gmip UTSW 8 70,266,251 (GRCm39) unclassified probably benign
R4282:Gmip UTSW 8 70,266,251 (GRCm39) unclassified probably benign
R4283:Gmip UTSW 8 70,266,251 (GRCm39) unclassified probably benign
R5221:Gmip UTSW 8 70,266,785 (GRCm39) missense probably damaging 1.00
R5512:Gmip UTSW 8 70,270,540 (GRCm39) missense probably benign 0.00
R5521:Gmip UTSW 8 70,270,049 (GRCm39) missense probably damaging 1.00
R5763:Gmip UTSW 8 70,270,501 (GRCm39) missense probably damaging 1.00
R6151:Gmip UTSW 8 70,269,735 (GRCm39) missense probably damaging 1.00
R6163:Gmip UTSW 8 70,270,022 (GRCm39) missense probably benign 0.28
R6228:Gmip UTSW 8 70,268,773 (GRCm39) missense probably damaging 1.00
R6775:Gmip UTSW 8 70,268,285 (GRCm39) missense possibly damaging 0.82
R6787:Gmip UTSW 8 70,266,436 (GRCm39) missense probably damaging 1.00
R6788:Gmip UTSW 8 70,263,826 (GRCm39) missense probably damaging 1.00
R6788:Gmip UTSW 8 70,263,824 (GRCm39) missense possibly damaging 0.87
R6852:Gmip UTSW 8 70,270,641 (GRCm39) nonsense probably null
R6934:Gmip UTSW 8 70,273,576 (GRCm39) missense probably benign
R7010:Gmip UTSW 8 70,264,050 (GRCm39) missense probably damaging 1.00
R7122:Gmip UTSW 8 70,270,452 (GRCm39) missense probably benign 0.02
R7254:Gmip UTSW 8 70,269,118 (GRCm39) splice site probably null
R7351:Gmip UTSW 8 70,270,034 (GRCm39) missense probably benign 0.01
R7360:Gmip UTSW 8 70,263,892 (GRCm39) missense probably damaging 1.00
R7412:Gmip UTSW 8 70,273,149 (GRCm39) missense probably benign
R7577:Gmip UTSW 8 70,267,085 (GRCm39) missense probably benign 0.17
R7718:Gmip UTSW 8 70,270,383 (GRCm39) missense probably damaging 0.99
R8018:Gmip UTSW 8 70,268,143 (GRCm39) missense probably benign 0.41
R8080:Gmip UTSW 8 70,268,736 (GRCm39) missense possibly damaging 0.50
R8694:Gmip UTSW 8 70,270,485 (GRCm39) missense probably benign
R8750:Gmip UTSW 8 70,273,134 (GRCm39) missense probably benign 0.01
R8826:Gmip UTSW 8 70,268,748 (GRCm39) missense possibly damaging 0.72
R8917:Gmip UTSW 8 70,270,428 (GRCm39) missense probably damaging 1.00
R8953:Gmip UTSW 8 70,269,427 (GRCm39) missense probably damaging 1.00
R9035:Gmip UTSW 8 70,273,298 (GRCm39) missense probably damaging 0.96
R9350:Gmip UTSW 8 70,263,832 (GRCm39) missense probably damaging 1.00
R9463:Gmip UTSW 8 70,269,693 (GRCm39) missense possibly damaging 0.46
R9547:Gmip UTSW 8 70,273,381 (GRCm39) missense possibly damaging 0.95
R9771:Gmip UTSW 8 70,266,718 (GRCm39) missense probably benign 0.44
X0063:Gmip UTSW 8 70,262,466 (GRCm39) missense probably damaging 1.00
Z1176:Gmip UTSW 8 70,268,942 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCTACAGCCTACCAGTGAC -3'
(R):5'- AAGTAAGGGGCTCATCTGGG -3'

Sequencing Primer
(F):5'- AGCCTACCAGTGACAGGCC -3'
(R):5'- CTCATCTGGGGTGGGAGCAG -3'
Posted On 2014-06-23