Mutagenetix > Incidental Mutation

Incidental Mutation 'R1801:Filip1'

203148

Institutional Source

Beutler Lab

Gene Symbol

Filip1

Ensembl Gene

ENSMUSG00000034898

Gene Name

filamin A interacting protein 1

Synonyms

5730485H21Rik

MMRRC Submission

039831-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.514) question?

Stock #

R1801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79815051-80012851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79815846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1164 (S1164P)

Ref Sequence

ENSEMBL: ENSMUSP00000091329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000093811
AA Change: S1164P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: S1164P

Domain	Start	End	E-Value	Type
Pfam:CortBP2	71	256	2.1e-64	PFAM
coiled coil region	258	540	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	579	592	N/A	INTRINSIC
coiled coil region	625	778	N/A	INTRINSIC
low complexity region	928	940	N/A	INTRINSIC
low complexity region	1126	1140	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1198	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172740

Predicted Effect

probably benign
Transcript: ENSMUST00000172973

SMART Domains

Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

Domain	Start	End	E-Value	Type
Pfam:CortBP2	65	225	5.2e-74	PFAM

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,067,396	E362G	probably damaging	Het
Abcc5	T	C	16: 20,338,887	M1307V	probably benign	Het
Adamts9	A	G	6: 92,863,376	V1142A	probably benign	Het
Ano10	T	C	9: 122,253,030	N525S	probably damaging	Het
Bpifa2	T	C	2: 154,011,504		probably null	Het
C7	C	T	15: 5,012,021	V468I	possibly damaging	Het
Carf	A	T	1: 60,141,505	H362L	possibly damaging	Het
Ccdc171	A	C	4: 83,546,895	I37L	probably benign	Het
Ccdc182	T	C	11: 88,294,190	L32P	possibly damaging	Het
Celsr3	A	T	9: 108,834,626	D1678V	possibly damaging	Het
Col7a1	A	T	9: 108,960,997	Y920F	unknown	Het
Cpsf3	T	C	12: 21,313,790	V627A	probably benign	Het
D7Ertd443e	A	G	7: 134,270,212	M640T	probably damaging	Het
Ddi2	T	C	4: 141,683,972	D543G	probably damaging	Het
Dnah9	T	C	11: 65,955,297	N2972D	probably damaging	Het
Dnajc18	T	C	18: 35,680,804	D304G	probably damaging	Het
Epg5	T	C	18: 77,983,490	V1232A	possibly damaging	Het
Ezr	T	C	17: 6,742,372	T358A	possibly damaging	Het
Gm14085	C	T	2: 122,521,652	R324C	possibly damaging	Het
Gm5346	A	T	8: 43,625,917	C423*	probably null	Het
Gmip	T	C	8: 69,814,477	V341A	probably benign	Het
Gnb3	A	C	6: 124,835,636	F286V	probably benign	Het
Gpatch2	T	A	1: 187,225,831	S128T	probably benign	Het
Gpr87	T	C	3: 59,179,392	R231G	possibly damaging	Het
Hip1r	G	A	5: 123,998,808	R613Q	probably benign	Het
Hsd3b7	T	C	7: 127,803,034	Y284H	possibly damaging	Het
Il1rap	A	T	16: 26,698,875	D275V	probably damaging	Het
Il4	G	T	11: 53,618,538	H23Q	possibly damaging	Het
Kit	A	G	5: 75,648,393	Y749C	probably damaging	Het
Klb	A	G	5: 65,349,235	K275R	probably null	Het
Klhl12	G	T	1: 134,489,070	R510L	probably damaging	Het
Lrrc8b	A	G	5: 105,480,823	Y345C	probably damaging	Het
Med15	T	C	16: 17,680,735	T98A	possibly damaging	Het
Mmp1a	T	A	9: 7,475,390	Y387N	probably damaging	Het
Myrf	C	A	19: 10,214,191	V928L	probably benign	Het
Nr1d1	T	C	11: 98,771,499	K134E	probably damaging	Het
Nrxn3	A	T	12: 90,283,582	D305V	probably damaging	Het
Obscn	A	C	11: 58,998,321	S7542A	unknown	Het
Olfr1197	T	A	2: 88,729,264	I112F	probably damaging	Het
Pak4	G	A	7: 28,565,190	R96C	probably damaging	Het
Papd5	T	G	8: 88,250,788	V406G	probably benign	Het
Pde6b	A	T	5: 108,427,847	D691V	possibly damaging	Het
Pdss2	A	G	10: 43,345,605	E171G	probably benign	Het
Pdzd2	C	T	15: 12,387,654	V873I	possibly damaging	Het
Plb1	A	T	5: 32,293,243	D376V	probably damaging	Het
Plekhg1	T	C	10: 3,963,904	Y1209H	probably damaging	Het
Prickle2	A	G	6: 92,416,904	C263R	probably damaging	Het
Psma2	A	T	13: 14,623,605	Y104F	probably benign	Het
Ptger4	T	A	15: 5,242,800	M113L	possibly damaging	Het
Rgs10	T	G	7: 128,404,477	D17A	possibly damaging	Het
Rpap3	A	G	15: 97,694,209	S189P	possibly damaging	Het
Rsbn1	T	C	3: 103,914,872	L102P	probably damaging	Het
Ryr2	T	C	13: 11,595,281	S655G	probably benign	Het
Samd4b	A	T	7: 28,407,331		probably null	Het
Sema4a	C	T	3: 88,436,749	D732N	probably benign	Het
Sh3bp5l	A	G	11: 58,346,351	D378G	probably benign	Het
Sh3gl3	C	T	7: 82,284,119	T230I	possibly damaging	Het
Slc5a1	A	T	5: 33,146,953	Q299L	probably damaging	Het
Ssc5d	C	A	7: 4,936,607	H681N	probably benign	Het
Sugp2	T	C	8: 70,236,710	S10P	possibly damaging	Het
Supt5	A	G	7: 28,317,214		probably null	Het
Syna	A	G	5: 134,560,089	V2A	probably benign	Het
Tcp1	T	A	17: 12,922,202	Y299*	probably null	Het
Tenm3	C	A	8: 48,276,256	V1572L	probably benign	Het
Trp53rka	A	G	2: 165,491,613	S119P	probably damaging	Het
Ubr4	T	A	4: 139,452,563		probably null	Het
Uchl4	T	A	9: 64,235,475	D79E	probably benign	Het
Vmn2r17	C	A	5: 109,428,478	T405K	probably damaging	Het
Xpnpep1	A	G	19: 53,010,133	L228P	probably damaging	Het
Xrcc4	T	G	13: 89,992,579	E170D	probably damaging	Het
Zfp945	T	C	17: 22,851,762	T388A	probably damaging	Het
Zfp947	G	A	17: 22,146,462	A77V	probably benign	Het
Zkscan5	G	A	5: 145,220,205	G433R	probably damaging	Het

Other mutations in Filip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Filip1	APN	9	79817944	missense	probably damaging	1.00
IGL01101:Filip1	APN	9	79898246	missense	probably benign	0.44
IGL01301:Filip1	APN	9	79819180	missense	possibly damaging	0.93
IGL01887:Filip1	APN	9	79819617	missense	probably benign	0.42
IGL02119:Filip1	APN	9	79818266	missense	probably benign
IGL02285:Filip1	APN	9	79820126	missense	probably damaging	1.00
IGL02395:Filip1	APN	9	79898410	missense	probably benign	0.01
IGL03398:Filip1	APN	9	79818943	missense	probably benign	0.03
IGL03400:Filip1	APN	9	79820473	missense	probably benign	0.01
IGL03404:Filip1	APN	9	79818559	missense	probably damaging	0.99
ANU18:Filip1	UTSW	9	79819180	missense	possibly damaging	0.93
BB010:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
BB020:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R0101:Filip1	UTSW	9	79819528	missense	probably benign	0.04
R0243:Filip1	UTSW	9	79819003	missense	probably damaging	0.98
R0244:Filip1	UTSW	9	79819462	missense	possibly damaging	0.87
R0371:Filip1	UTSW	9	79860091	missense	probably damaging	1.00
R0399:Filip1	UTSW	9	79818310	missense	possibly damaging	0.71
R0412:Filip1	UTSW	9	79820289	missense	possibly damaging	0.59
R0671:Filip1	UTSW	9	79819390	missense	probably damaging	1.00
R1314:Filip1	UTSW	9	79820566	missense	probably damaging	1.00
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1602:Filip1	UTSW	9	79820591	missense	probably damaging	0.99
R1929:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R1983:Filip1	UTSW	9	79860092	missense	probably damaging	1.00
R2066:Filip1	UTSW	9	79820216	missense	probably damaging	1.00
R2128:Filip1	UTSW	9	79819330	missense	probably damaging	0.99
R2271:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2411:Filip1	UTSW	9	79898433	missense	probably damaging	0.98
R3429:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3430:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3945:Filip1	UTSW	9	79818367	missense	probably benign	0.01
R4007:Filip1	UTSW	9	79818727	missense	possibly damaging	0.71
R4583:Filip1	UTSW	9	79815809	missense	possibly damaging	0.76
R4803:Filip1	UTSW	9	79820114	missense	probably benign	0.05
R4837:Filip1	UTSW	9	79819459	missense	probably damaging	0.98
R4910:Filip1	UTSW	9	79817932	missense	probably benign	0.00
R4929:Filip1	UTSW	9	79819747	missense	probably benign	0.07
R5387:Filip1	UTSW	9	79818274	missense	probably benign
R5581:Filip1	UTSW	9	79819760	missense	possibly damaging	0.95
R5808:Filip1	UTSW	9	79818701	missense	possibly damaging	0.67
R5891:Filip1	UTSW	9	79819860	missense	possibly damaging	0.69
R6166:Filip1	UTSW	9	79819454	missense	probably damaging	0.99
R6273:Filip1	UTSW	9	79815886	missense	probably benign	0.01
R6380:Filip1	UTSW	9	79819624	missense	probably damaging	0.99
R6385:Filip1	UTSW	9	79820531	missense	possibly damaging	0.68
R6614:Filip1	UTSW	9	79815839	missense	probably damaging	1.00
R6715:Filip1	UTSW	9	79818758	missense	probably benign	0.03
R7047:Filip1	UTSW	9	79853634	missense	probably damaging	0.98
R7126:Filip1	UTSW	9	79898295	missense	possibly damaging	0.88
R7144:Filip1	UTSW	9	79820213	missense	possibly damaging	0.65
R7218:Filip1	UTSW	9	79818074	missense	probably benign
R7404:Filip1	UTSW	9	79820098	missense	possibly damaging	0.94
R7702:Filip1	UTSW	9	79820649	missense	probably benign	0.20
R7866:Filip1	UTSW	9	79818943	missense	probably benign	0.03
R7933:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R8012:Filip1	UTSW	9	79817959	missense	probably damaging	0.97
R8097:Filip1	UTSW	9	79818259	missense	probably benign
R8213:Filip1	UTSW	9	79818092	missense	probably benign	0.01
R8305:Filip1	UTSW	9	79820475	nonsense	probably null
R8798:Filip1	UTSW	9	79820090	missense	possibly damaging	0.94
R9184:Filip1	UTSW	9	79898260	missense	probably benign	0.03
R9322:Filip1	UTSW	9	79819732	missense	probably benign	0.01
R9334:Filip1	UTSW	9	79818457	missense	probably benign	0.32
R9353:Filip1	UTSW	9	79818341	missense	possibly damaging	0.67
R9541:Filip1	UTSW	9	79819853	nonsense	probably null
R9607:Filip1	UTSW	9	79819120	missense	probably damaging	1.00
X0054:Filip1	UTSW	9	79819535	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGAAGGTTTGTTTCCACAGC -3'
(R):5'- CAACCCTTTTCCCTAGGATGG -3'

Sequencing Primer
(F):5'- TGTTTCCACAGCAGCAGTAG -3'
(R):5'- GGTTGTTGTGAAATGCCCC -3'

Posted On

2014-06-23