Incidental Mutation 'R1801:Filip1'
ID 203148
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Name filamin A interacting protein 1
Synonyms FILIP, 5730485H21Rik
MMRRC Submission 039831-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.499) question?
Stock # R1801 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 79712376-79920133 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79723128 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1164 (S1164P)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000093811
AA Change: S1164P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: S1164P

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172740
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,903,230 (GRCm39) E362G probably damaging Het
Abcc5 T C 16: 20,157,637 (GRCm39) M1307V probably benign Het
Adam34l A T 8: 44,078,954 (GRCm39) C423* probably null Het
Adamts9 A G 6: 92,840,357 (GRCm39) V1142A probably benign Het
Ano10 T C 9: 122,082,096 (GRCm39) N525S probably damaging Het
Bpifa2 T C 2: 153,853,424 (GRCm39) probably null Het
C7 C T 15: 5,041,503 (GRCm39) V468I possibly damaging Het
Carf A T 1: 60,180,664 (GRCm39) H362L possibly damaging Het
Ccdc171 A C 4: 83,465,132 (GRCm39) I37L probably benign Het
Ccdc182 T C 11: 88,185,016 (GRCm39) L32P possibly damaging Het
Celsr3 A T 9: 108,711,825 (GRCm39) D1678V possibly damaging Het
Col7a1 A T 9: 108,790,065 (GRCm39) Y920F unknown Het
Cpsf3 T C 12: 21,363,791 (GRCm39) V627A probably benign Het
D7Ertd443e A G 7: 133,871,941 (GRCm39) M640T probably damaging Het
Ddi2 T C 4: 141,411,283 (GRCm39) D543G probably damaging Het
Dnah9 T C 11: 65,846,123 (GRCm39) N2972D probably damaging Het
Dnajc18 T C 18: 35,813,857 (GRCm39) D304G probably damaging Het
Epg5 T C 18: 78,026,705 (GRCm39) V1232A possibly damaging Het
Ezr T C 17: 7,009,771 (GRCm39) T358A possibly damaging Het
Gmip T C 8: 70,267,127 (GRCm39) V341A probably benign Het
Gnb3 A C 6: 124,812,599 (GRCm39) F286V probably benign Het
Gpatch2 T A 1: 186,958,028 (GRCm39) S128T probably benign Het
Gpr87 T C 3: 59,086,813 (GRCm39) R231G possibly damaging Het
Hip1r G A 5: 124,136,871 (GRCm39) R613Q probably benign Het
Hsd3b7 T C 7: 127,402,206 (GRCm39) Y284H possibly damaging Het
Il1rap A T 16: 26,517,625 (GRCm39) D275V probably damaging Het
Il4 G T 11: 53,509,365 (GRCm39) H23Q possibly damaging Het
Kit A G 5: 75,809,053 (GRCm39) Y749C probably damaging Het
Klb A G 5: 65,506,578 (GRCm39) K275R probably null Het
Klhl12 G T 1: 134,416,808 (GRCm39) R510L probably damaging Het
Lrrc8b A G 5: 105,628,689 (GRCm39) Y345C probably damaging Het
Med15 T C 16: 17,498,599 (GRCm39) T98A possibly damaging Het
Mmp1a T A 9: 7,475,391 (GRCm39) Y387N probably damaging Het
Myrf C A 19: 10,191,555 (GRCm39) V928L probably benign Het
Nr1d1 T C 11: 98,662,325 (GRCm39) K134E probably damaging Het
Nrxn3 A T 12: 90,250,356 (GRCm39) D305V probably damaging Het
Obscn A C 11: 58,889,147 (GRCm39) S7542A unknown Het
Or4a27 T A 2: 88,559,608 (GRCm39) I112F probably damaging Het
Pak4 G A 7: 28,264,615 (GRCm39) R96C probably damaging Het
Pde6b A T 5: 108,575,713 (GRCm39) D691V possibly damaging Het
Pdss2 A G 10: 43,221,601 (GRCm39) E171G probably benign Het
Pdzd2 C T 15: 12,387,740 (GRCm39) V873I possibly damaging Het
Plb1 A T 5: 32,450,587 (GRCm39) D376V probably damaging Het
Plekhg1 T C 10: 3,913,904 (GRCm39) Y1209H probably damaging Het
Prickle2 A G 6: 92,393,885 (GRCm39) C263R probably damaging Het
Psma2 A T 13: 14,798,190 (GRCm39) Y104F probably benign Het
Ptger4 T A 15: 5,272,281 (GRCm39) M113L possibly damaging Het
Rgs10 T G 7: 128,006,201 (GRCm39) D17A possibly damaging Het
Rpap3 A G 15: 97,592,090 (GRCm39) S189P possibly damaging Het
Rsbn1 T C 3: 103,822,188 (GRCm39) L102P probably damaging Het
Ryr2 T C 13: 11,610,167 (GRCm39) S655G probably benign Het
Samd4b A T 7: 28,106,756 (GRCm39) probably null Het
Sema4a C T 3: 88,344,056 (GRCm39) D732N probably benign Het
Sh3bp5l A G 11: 58,237,177 (GRCm39) D378G probably benign Het
Sh3gl3 C T 7: 81,933,327 (GRCm39) T230I possibly damaging Het
Slc28a2b C T 2: 122,352,133 (GRCm39) R324C possibly damaging Het
Slc5a1 A T 5: 33,304,297 (GRCm39) Q299L probably damaging Het
Ssc5d C A 7: 4,939,606 (GRCm39) H681N probably benign Het
Sugp2 T C 8: 70,689,360 (GRCm39) S10P possibly damaging Het
Supt5 A G 7: 28,016,639 (GRCm39) probably null Het
Syna A G 5: 134,588,943 (GRCm39) V2A probably benign Het
Tcp1 T A 17: 13,141,089 (GRCm39) Y299* probably null Het
Tenm3 C A 8: 48,729,291 (GRCm39) V1572L probably benign Het
Tent4b T G 8: 88,977,416 (GRCm39) V406G probably benign Het
Trp53rka A G 2: 165,333,533 (GRCm39) S119P probably damaging Het
Ubr4 T A 4: 139,179,874 (GRCm39) probably null Het
Uchl4 T A 9: 64,142,757 (GRCm39) D79E probably benign Het
Vmn2r17 C A 5: 109,576,344 (GRCm39) T405K probably damaging Het
Xpnpep1 A G 19: 52,998,564 (GRCm39) L228P probably damaging Het
Xrcc4 T G 13: 90,140,698 (GRCm39) E170D probably damaging Het
Zfp945 T C 17: 23,070,736 (GRCm39) T388A probably damaging Het
Zfp947 G A 17: 22,365,443 (GRCm39) A77V probably benign Het
Zkscan5 G A 5: 145,157,015 (GRCm39) G433R probably damaging Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79,725,226 (GRCm39) missense probably damaging 1.00
IGL01101:Filip1 APN 9 79,805,528 (GRCm39) missense probably benign 0.44
IGL01301:Filip1 APN 9 79,726,462 (GRCm39) missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79,726,899 (GRCm39) missense probably benign 0.42
IGL02119:Filip1 APN 9 79,725,548 (GRCm39) missense probably benign
IGL02285:Filip1 APN 9 79,727,408 (GRCm39) missense probably damaging 1.00
IGL02395:Filip1 APN 9 79,805,692 (GRCm39) missense probably benign 0.01
IGL03398:Filip1 APN 9 79,726,225 (GRCm39) missense probably benign 0.03
IGL03400:Filip1 APN 9 79,727,755 (GRCm39) missense probably benign 0.01
IGL03404:Filip1 APN 9 79,725,841 (GRCm39) missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79,726,462 (GRCm39) missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79,726,810 (GRCm39) missense probably benign 0.04
R0243:Filip1 UTSW 9 79,726,285 (GRCm39) missense probably damaging 0.98
R0244:Filip1 UTSW 9 79,726,744 (GRCm39) missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79,767,373 (GRCm39) missense probably damaging 1.00
R0399:Filip1 UTSW 9 79,725,592 (GRCm39) missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79,727,571 (GRCm39) missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79,726,672 (GRCm39) missense probably damaging 1.00
R1314:Filip1 UTSW 9 79,727,848 (GRCm39) missense probably damaging 1.00
R1465:Filip1 UTSW 9 79,805,589 (GRCm39) missense probably benign 0.25
R1465:Filip1 UTSW 9 79,805,589 (GRCm39) missense probably benign 0.25
R1602:Filip1 UTSW 9 79,727,873 (GRCm39) missense probably damaging 0.99
R1929:Filip1 UTSW 9 79,727,212 (GRCm39) missense probably damaging 1.00
R1983:Filip1 UTSW 9 79,767,374 (GRCm39) missense probably damaging 1.00
R2066:Filip1 UTSW 9 79,727,498 (GRCm39) missense probably damaging 1.00
R2128:Filip1 UTSW 9 79,726,612 (GRCm39) missense probably damaging 0.99
R2271:Filip1 UTSW 9 79,727,212 (GRCm39) missense probably damaging 1.00
R2411:Filip1 UTSW 9 79,805,715 (GRCm39) missense probably damaging 0.98
R3429:Filip1 UTSW 9 79,760,952 (GRCm39) missense probably damaging 1.00
R3430:Filip1 UTSW 9 79,760,952 (GRCm39) missense probably damaging 1.00
R3945:Filip1 UTSW 9 79,725,649 (GRCm39) missense probably benign 0.01
R4007:Filip1 UTSW 9 79,726,009 (GRCm39) missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79,723,091 (GRCm39) missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79,727,396 (GRCm39) missense probably benign 0.05
R4837:Filip1 UTSW 9 79,726,741 (GRCm39) missense probably damaging 0.98
R4910:Filip1 UTSW 9 79,725,214 (GRCm39) missense probably benign 0.00
R4929:Filip1 UTSW 9 79,727,029 (GRCm39) missense probably benign 0.07
R5387:Filip1 UTSW 9 79,725,556 (GRCm39) missense probably benign
R5581:Filip1 UTSW 9 79,727,042 (GRCm39) missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79,725,983 (GRCm39) missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79,727,142 (GRCm39) missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79,726,736 (GRCm39) missense probably damaging 0.99
R6273:Filip1 UTSW 9 79,723,168 (GRCm39) missense probably benign 0.01
R6380:Filip1 UTSW 9 79,726,906 (GRCm39) missense probably damaging 0.99
R6385:Filip1 UTSW 9 79,727,813 (GRCm39) missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79,723,121 (GRCm39) missense probably damaging 1.00
R6715:Filip1 UTSW 9 79,726,040 (GRCm39) missense probably benign 0.03
R7047:Filip1 UTSW 9 79,760,916 (GRCm39) missense probably damaging 0.98
R7126:Filip1 UTSW 9 79,805,577 (GRCm39) missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79,727,495 (GRCm39) missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79,725,356 (GRCm39) missense probably benign
R7404:Filip1 UTSW 9 79,727,380 (GRCm39) missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79,727,931 (GRCm39) missense probably benign 0.20
R7866:Filip1 UTSW 9 79,726,225 (GRCm39) missense probably benign 0.03
R7933:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79,725,241 (GRCm39) missense probably damaging 0.97
R8097:Filip1 UTSW 9 79,725,541 (GRCm39) missense probably benign
R8213:Filip1 UTSW 9 79,725,374 (GRCm39) missense probably benign 0.01
R8305:Filip1 UTSW 9 79,727,757 (GRCm39) nonsense probably null
R8798:Filip1 UTSW 9 79,727,372 (GRCm39) missense possibly damaging 0.94
R9184:Filip1 UTSW 9 79,805,542 (GRCm39) missense probably benign 0.03
R9322:Filip1 UTSW 9 79,727,014 (GRCm39) missense probably benign 0.01
R9334:Filip1 UTSW 9 79,725,739 (GRCm39) missense probably benign 0.32
R9353:Filip1 UTSW 9 79,725,623 (GRCm39) missense possibly damaging 0.67
R9541:Filip1 UTSW 9 79,727,135 (GRCm39) nonsense probably null
R9607:Filip1 UTSW 9 79,726,402 (GRCm39) missense probably damaging 1.00
X0054:Filip1 UTSW 9 79,726,817 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGAAGGTTTGTTTCCACAGC -3'
(R):5'- CAACCCTTTTCCCTAGGATGG -3'

Sequencing Primer
(F):5'- TGTTTCCACAGCAGCAGTAG -3'
(R):5'- GGTTGTTGTGAAATGCCCC -3'
Posted On 2014-06-23