Incidental Mutation 'R1801:Celsr3'
ID 203149
Institutional Source Beutler Lab
Gene Symbol Celsr3
Ensembl Gene ENSMUSG00000023473
Gene Name cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms Fmi1, flamingo, Adgrc3
MMRRC Submission 039831-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1801 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 108703519-108730168 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108711825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1678 (D1678V)
Ref Sequence ENSEMBL: ENSMUSP00000024238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000192235] [ENSMUST00000213524]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000024238
AA Change: D1678V

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: D1678V

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192235
SMART Domains Protein: ENSMUSP00000141429
Gene: ENSMUSG00000023473

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
EGF 108 163 4.9e-5 SMART
EGF 168 201 2.6e-6 SMART
EGF_like 208 239 1.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193726
Predicted Effect probably benign
Transcript: ENSMUST00000213524
AA Change: D1680V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,903,230 (GRCm39) E362G probably damaging Het
Abcc5 T C 16: 20,157,637 (GRCm39) M1307V probably benign Het
Adam34l A T 8: 44,078,954 (GRCm39) C423* probably null Het
Adamts9 A G 6: 92,840,357 (GRCm39) V1142A probably benign Het
Ano10 T C 9: 122,082,096 (GRCm39) N525S probably damaging Het
Bpifa2 T C 2: 153,853,424 (GRCm39) probably null Het
C7 C T 15: 5,041,503 (GRCm39) V468I possibly damaging Het
Carf A T 1: 60,180,664 (GRCm39) H362L possibly damaging Het
Ccdc171 A C 4: 83,465,132 (GRCm39) I37L probably benign Het
Ccdc182 T C 11: 88,185,016 (GRCm39) L32P possibly damaging Het
Col7a1 A T 9: 108,790,065 (GRCm39) Y920F unknown Het
Cpsf3 T C 12: 21,363,791 (GRCm39) V627A probably benign Het
D7Ertd443e A G 7: 133,871,941 (GRCm39) M640T probably damaging Het
Ddi2 T C 4: 141,411,283 (GRCm39) D543G probably damaging Het
Dnah9 T C 11: 65,846,123 (GRCm39) N2972D probably damaging Het
Dnajc18 T C 18: 35,813,857 (GRCm39) D304G probably damaging Het
Epg5 T C 18: 78,026,705 (GRCm39) V1232A possibly damaging Het
Ezr T C 17: 7,009,771 (GRCm39) T358A possibly damaging Het
Filip1 A G 9: 79,723,128 (GRCm39) S1164P probably damaging Het
Gmip T C 8: 70,267,127 (GRCm39) V341A probably benign Het
Gnb3 A C 6: 124,812,599 (GRCm39) F286V probably benign Het
Gpatch2 T A 1: 186,958,028 (GRCm39) S128T probably benign Het
Gpr87 T C 3: 59,086,813 (GRCm39) R231G possibly damaging Het
Hip1r G A 5: 124,136,871 (GRCm39) R613Q probably benign Het
Hsd3b7 T C 7: 127,402,206 (GRCm39) Y284H possibly damaging Het
Il1rap A T 16: 26,517,625 (GRCm39) D275V probably damaging Het
Il4 G T 11: 53,509,365 (GRCm39) H23Q possibly damaging Het
Kit A G 5: 75,809,053 (GRCm39) Y749C probably damaging Het
Klb A G 5: 65,506,578 (GRCm39) K275R probably null Het
Klhl12 G T 1: 134,416,808 (GRCm39) R510L probably damaging Het
Lrrc8b A G 5: 105,628,689 (GRCm39) Y345C probably damaging Het
Med15 T C 16: 17,498,599 (GRCm39) T98A possibly damaging Het
Mmp1a T A 9: 7,475,391 (GRCm39) Y387N probably damaging Het
Myrf C A 19: 10,191,555 (GRCm39) V928L probably benign Het
Nr1d1 T C 11: 98,662,325 (GRCm39) K134E probably damaging Het
Nrxn3 A T 12: 90,250,356 (GRCm39) D305V probably damaging Het
Obscn A C 11: 58,889,147 (GRCm39) S7542A unknown Het
Or4a27 T A 2: 88,559,608 (GRCm39) I112F probably damaging Het
Pak4 G A 7: 28,264,615 (GRCm39) R96C probably damaging Het
Pde6b A T 5: 108,575,713 (GRCm39) D691V possibly damaging Het
Pdss2 A G 10: 43,221,601 (GRCm39) E171G probably benign Het
Pdzd2 C T 15: 12,387,740 (GRCm39) V873I possibly damaging Het
Plb1 A T 5: 32,450,587 (GRCm39) D376V probably damaging Het
Plekhg1 T C 10: 3,913,904 (GRCm39) Y1209H probably damaging Het
Prickle2 A G 6: 92,393,885 (GRCm39) C263R probably damaging Het
Psma2 A T 13: 14,798,190 (GRCm39) Y104F probably benign Het
Ptger4 T A 15: 5,272,281 (GRCm39) M113L possibly damaging Het
Rgs10 T G 7: 128,006,201 (GRCm39) D17A possibly damaging Het
Rpap3 A G 15: 97,592,090 (GRCm39) S189P possibly damaging Het
Rsbn1 T C 3: 103,822,188 (GRCm39) L102P probably damaging Het
Ryr2 T C 13: 11,610,167 (GRCm39) S655G probably benign Het
Samd4b A T 7: 28,106,756 (GRCm39) probably null Het
Sema4a C T 3: 88,344,056 (GRCm39) D732N probably benign Het
Sh3bp5l A G 11: 58,237,177 (GRCm39) D378G probably benign Het
Sh3gl3 C T 7: 81,933,327 (GRCm39) T230I possibly damaging Het
Slc28a2b C T 2: 122,352,133 (GRCm39) R324C possibly damaging Het
Slc5a1 A T 5: 33,304,297 (GRCm39) Q299L probably damaging Het
Ssc5d C A 7: 4,939,606 (GRCm39) H681N probably benign Het
Sugp2 T C 8: 70,689,360 (GRCm39) S10P possibly damaging Het
Supt5 A G 7: 28,016,639 (GRCm39) probably null Het
Syna A G 5: 134,588,943 (GRCm39) V2A probably benign Het
Tcp1 T A 17: 13,141,089 (GRCm39) Y299* probably null Het
Tenm3 C A 8: 48,729,291 (GRCm39) V1572L probably benign Het
Tent4b T G 8: 88,977,416 (GRCm39) V406G probably benign Het
Trp53rka A G 2: 165,333,533 (GRCm39) S119P probably damaging Het
Ubr4 T A 4: 139,179,874 (GRCm39) probably null Het
Uchl4 T A 9: 64,142,757 (GRCm39) D79E probably benign Het
Vmn2r17 C A 5: 109,576,344 (GRCm39) T405K probably damaging Het
Xpnpep1 A G 19: 52,998,564 (GRCm39) L228P probably damaging Het
Xrcc4 T G 13: 90,140,698 (GRCm39) E170D probably damaging Het
Zfp945 T C 17: 23,070,736 (GRCm39) T388A probably damaging Het
Zfp947 G A 17: 22,365,443 (GRCm39) A77V probably benign Het
Zkscan5 G A 5: 145,157,015 (GRCm39) G433R probably damaging Het
Other mutations in Celsr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Celsr3 APN 9 108,726,124 (GRCm39) missense probably damaging 1.00
IGL00536:Celsr3 APN 9 108,706,391 (GRCm39) missense probably benign 0.33
IGL00552:Celsr3 APN 9 108,718,462 (GRCm39) missense possibly damaging 0.88
IGL00801:Celsr3 APN 9 108,719,775 (GRCm39) missense probably benign
IGL01420:Celsr3 APN 9 108,718,389 (GRCm39) critical splice acceptor site probably null
IGL01541:Celsr3 APN 9 108,708,907 (GRCm39) missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108,711,756 (GRCm39) missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108,714,603 (GRCm39) missense probably benign 0.00
IGL01631:Celsr3 APN 9 108,714,603 (GRCm39) missense probably benign 0.00
IGL01777:Celsr3 APN 9 108,713,141 (GRCm39) missense probably benign 0.08
IGL01938:Celsr3 APN 9 108,705,614 (GRCm39) missense probably benign 0.34
IGL02135:Celsr3 APN 9 108,704,755 (GRCm39) missense probably benign 0.11
IGL02231:Celsr3 APN 9 108,719,709 (GRCm39) missense probably damaging 1.00
IGL02234:Celsr3 APN 9 108,707,159 (GRCm39) missense probably benign
IGL02392:Celsr3 APN 9 108,711,920 (GRCm39) splice site probably benign
IGL02416:Celsr3 APN 9 108,709,318 (GRCm39) missense probably damaging 1.00
IGL02421:Celsr3 APN 9 108,717,662 (GRCm39) missense probably damaging 1.00
IGL02455:Celsr3 APN 9 108,720,092 (GRCm39) missense probably benign 0.15
IGL02798:Celsr3 APN 9 108,720,774 (GRCm39) missense probably damaging 1.00
IGL02939:Celsr3 APN 9 108,726,652 (GRCm39) missense probably damaging 1.00
IGL02947:Celsr3 APN 9 108,723,134 (GRCm39) missense probably benign 0.12
IGL02986:Celsr3 APN 9 108,718,454 (GRCm39) splice site probably null
IGL03089:Celsr3 APN 9 108,703,806 (GRCm39) missense probably benign 0.04
IGL03162:Celsr3 APN 9 108,719,757 (GRCm39) missense probably damaging 1.00
IGL03267:Celsr3 APN 9 108,713,724 (GRCm39) splice site probably benign
Diminishment UTSW 9 108,719,907 (GRCm39) intron probably benign
little_d UTSW 9 108,704,891 (GRCm39) missense probably damaging 0.98
nogal UTSW 9 108,713,037 (GRCm39) missense probably benign
F6893:Celsr3 UTSW 9 108,712,266 (GRCm39) missense probably benign 0.00
PIT4243001:Celsr3 UTSW 9 108,709,507 (GRCm39) missense probably benign 0.13
PIT4810001:Celsr3 UTSW 9 108,722,932 (GRCm39) missense probably damaging 1.00
R0110:Celsr3 UTSW 9 108,704,204 (GRCm39) missense possibly damaging 0.62
R0243:Celsr3 UTSW 9 108,720,923 (GRCm39) splice site probably benign
R0382:Celsr3 UTSW 9 108,706,417 (GRCm39) missense probably damaging 1.00
R0482:Celsr3 UTSW 9 108,706,272 (GRCm39) nonsense probably null
R0510:Celsr3 UTSW 9 108,704,204 (GRCm39) missense possibly damaging 0.62
R0630:Celsr3 UTSW 9 108,704,891 (GRCm39) missense probably damaging 0.98
R0656:Celsr3 UTSW 9 108,711,854 (GRCm39) missense possibly damaging 0.89
R0764:Celsr3 UTSW 9 108,705,017 (GRCm39) missense probably damaging 1.00
R0883:Celsr3 UTSW 9 108,719,832 (GRCm39) missense probably damaging 1.00
R0924:Celsr3 UTSW 9 108,723,224 (GRCm39) missense possibly damaging 0.78
R1015:Celsr3 UTSW 9 108,710,375 (GRCm39) missense probably benign 0.17
R1321:Celsr3 UTSW 9 108,713,069 (GRCm39) missense probably damaging 1.00
R1423:Celsr3 UTSW 9 108,704,104 (GRCm39) missense probably benign 0.00
R1497:Celsr3 UTSW 9 108,726,064 (GRCm39) missense probably benign 0.14
R1520:Celsr3 UTSW 9 108,725,857 (GRCm39) missense probably damaging 1.00
R1534:Celsr3 UTSW 9 108,726,083 (GRCm39) missense probably damaging 0.99
R1569:Celsr3 UTSW 9 108,706,267 (GRCm39) missense probably damaging 1.00
R1657:Celsr3 UTSW 9 108,720,151 (GRCm39) nonsense probably null
R1753:Celsr3 UTSW 9 108,709,056 (GRCm39) missense probably damaging 0.99
R1764:Celsr3 UTSW 9 108,706,157 (GRCm39) missense probably damaging 1.00
R1838:Celsr3 UTSW 9 108,707,105 (GRCm39) missense probably benign
R1839:Celsr3 UTSW 9 108,707,105 (GRCm39) missense probably benign
R1874:Celsr3 UTSW 9 108,713,037 (GRCm39) missense probably benign
R1875:Celsr3 UTSW 9 108,713,037 (GRCm39) missense probably benign
R1953:Celsr3 UTSW 9 108,720,381 (GRCm39) missense probably benign 0.19
R1960:Celsr3 UTSW 9 108,723,016 (GRCm39) missense probably benign
R2113:Celsr3 UTSW 9 108,715,669 (GRCm39) missense probably damaging 1.00
R2290:Celsr3 UTSW 9 108,720,423 (GRCm39) missense probably damaging 1.00
R2369:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R2373:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R2374:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R2375:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R2844:Celsr3 UTSW 9 108,706,507 (GRCm39) missense probably damaging 1.00
R2968:Celsr3 UTSW 9 108,709,390 (GRCm39) missense probably damaging 1.00
R3103:Celsr3 UTSW 9 108,714,338 (GRCm39) missense probably benign 0.31
R3159:Celsr3 UTSW 9 108,704,909 (GRCm39) missense possibly damaging 0.94
R3791:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R4194:Celsr3 UTSW 9 108,720,501 (GRCm39) critical splice donor site probably null
R4329:Celsr3 UTSW 9 108,723,248 (GRCm39) missense probably benign 0.00
R4365:Celsr3 UTSW 9 108,707,046 (GRCm39) missense possibly damaging 0.47
R4419:Celsr3 UTSW 9 108,720,443 (GRCm39) missense possibly damaging 0.84
R4484:Celsr3 UTSW 9 108,723,262 (GRCm39) critical splice donor site probably null
R4582:Celsr3 UTSW 9 108,722,922 (GRCm39) missense probably damaging 1.00
R4681:Celsr3 UTSW 9 108,704,953 (GRCm39) missense possibly damaging 0.58
R4729:Celsr3 UTSW 9 108,724,851 (GRCm39) missense probably benign 0.05
R4881:Celsr3 UTSW 9 108,721,140 (GRCm39) missense probably damaging 1.00
R4893:Celsr3 UTSW 9 108,726,620 (GRCm39) missense probably damaging 1.00
R5183:Celsr3 UTSW 9 108,714,759 (GRCm39) missense probably damaging 0.99
R5207:Celsr3 UTSW 9 108,709,958 (GRCm39) missense probably benign 0.01
R5290:Celsr3 UTSW 9 108,720,357 (GRCm39) missense probably benign 0.01
R5327:Celsr3 UTSW 9 108,719,907 (GRCm39) intron probably benign
R5345:Celsr3 UTSW 9 108,709,323 (GRCm39) missense probably damaging 1.00
R5358:Celsr3 UTSW 9 108,709,224 (GRCm39) missense possibly damaging 0.96
R5396:Celsr3 UTSW 9 108,705,781 (GRCm39) missense probably damaging 1.00
R5414:Celsr3 UTSW 9 108,717,241 (GRCm39) missense possibly damaging 0.88
R5452:Celsr3 UTSW 9 108,721,233 (GRCm39) missense possibly damaging 0.68
R5467:Celsr3 UTSW 9 108,705,836 (GRCm39) missense probably damaging 1.00
R5479:Celsr3 UTSW 9 108,721,743 (GRCm39) critical splice donor site probably null
R5629:Celsr3 UTSW 9 108,726,266 (GRCm39) missense probably benign 0.41
R5637:Celsr3 UTSW 9 108,714,332 (GRCm39) missense probably damaging 1.00
R5652:Celsr3 UTSW 9 108,715,671 (GRCm39) missense probably benign 0.03
R5739:Celsr3 UTSW 9 108,704,357 (GRCm39) missense probably benign
R5785:Celsr3 UTSW 9 108,704,996 (GRCm39) missense probably damaging 1.00
R5877:Celsr3 UTSW 9 108,722,926 (GRCm39) missense probably damaging 0.98
R5961:Celsr3 UTSW 9 108,708,993 (GRCm39) missense probably damaging 1.00
R6046:Celsr3 UTSW 9 108,714,350 (GRCm39) missense probably benign 0.01
R6176:Celsr3 UTSW 9 108,705,554 (GRCm39) missense probably damaging 1.00
R6291:Celsr3 UTSW 9 108,706,041 (GRCm39) missense probably damaging 1.00
R6468:Celsr3 UTSW 9 108,712,989 (GRCm39) missense probably benign 0.08
R6481:Celsr3 UTSW 9 108,714,283 (GRCm39) missense possibly damaging 0.92
R6547:Celsr3 UTSW 9 108,706,327 (GRCm39) missense probably damaging 1.00
R6763:Celsr3 UTSW 9 108,704,549 (GRCm39) missense probably damaging 1.00
R6870:Celsr3 UTSW 9 108,706,390 (GRCm39) missense probably benign 0.02
R6977:Celsr3 UTSW 9 108,704,914 (GRCm39) missense probably benign
R7061:Celsr3 UTSW 9 108,724,793 (GRCm39) nonsense probably null
R7122:Celsr3 UTSW 9 108,705,766 (GRCm39) missense possibly damaging 0.90
R7156:Celsr3 UTSW 9 108,715,203 (GRCm39) missense possibly damaging 0.95
R7166:Celsr3 UTSW 9 108,720,150 (GRCm39) missense probably damaging 1.00
R7176:Celsr3 UTSW 9 108,722,961 (GRCm39) missense probably benign
R7213:Celsr3 UTSW 9 108,726,239 (GRCm39) missense probably damaging 0.98
R7314:Celsr3 UTSW 9 108,706,343 (GRCm39) missense probably damaging 1.00
R7478:Celsr3 UTSW 9 108,720,777 (GRCm39) missense probably benign 0.37
R7508:Celsr3 UTSW 9 108,713,821 (GRCm39) missense probably benign
R7554:Celsr3 UTSW 9 108,718,408 (GRCm39) missense probably benign
R7615:Celsr3 UTSW 9 108,714,851 (GRCm39) missense possibly damaging 0.75
R7653:Celsr3 UTSW 9 108,712,269 (GRCm39) nonsense probably null
R7747:Celsr3 UTSW 9 108,707,177 (GRCm39) missense possibly damaging 0.61
R7881:Celsr3 UTSW 9 108,705,271 (GRCm39) missense probably benign 0.28
R7935:Celsr3 UTSW 9 108,706,840 (GRCm39) missense probably benign 0.01
R7995:Celsr3 UTSW 9 108,722,282 (GRCm39) missense probably damaging 0.99
R8006:Celsr3 UTSW 9 108,706,306 (GRCm39) missense probably damaging 1.00
R8077:Celsr3 UTSW 9 108,705,530 (GRCm39) missense probably benign 0.15
R8284:Celsr3 UTSW 9 108,723,612 (GRCm39) missense probably damaging 0.99
R8291:Celsr3 UTSW 9 108,715,169 (GRCm39) missense probably damaging 1.00
R8322:Celsr3 UTSW 9 108,725,993 (GRCm39) missense probably damaging 1.00
R8334:Celsr3 UTSW 9 108,718,471 (GRCm39) frame shift probably null
R8337:Celsr3 UTSW 9 108,718,471 (GRCm39) frame shift probably null
R8338:Celsr3 UTSW 9 108,704,539 (GRCm39) nonsense probably null
R8353:Celsr3 UTSW 9 108,703,734 (GRCm39) missense probably benign 0.00
R8407:Celsr3 UTSW 9 108,706,256 (GRCm39) missense probably damaging 1.00
R8408:Celsr3 UTSW 9 108,708,988 (GRCm39) missense probably damaging 1.00
R8459:Celsr3 UTSW 9 108,706,829 (GRCm39) missense probably damaging 1.00
R8510:Celsr3 UTSW 9 108,715,319 (GRCm39) missense possibly damaging 0.93
R8713:Celsr3 UTSW 9 108,707,062 (GRCm39) missense probably benign
R8728:Celsr3 UTSW 9 108,723,940 (GRCm39) missense probably benign 0.24
R8829:Celsr3 UTSW 9 108,717,582 (GRCm39) missense probably benign
R8877:Celsr3 UTSW 9 108,706,877 (GRCm39) missense probably damaging 1.00
R8905:Celsr3 UTSW 9 108,718,501 (GRCm39) missense probably damaging 1.00
R9008:Celsr3 UTSW 9 108,706,151 (GRCm39) missense possibly damaging 0.94
R9072:Celsr3 UTSW 9 108,704,293 (GRCm39) missense probably benign
R9157:Celsr3 UTSW 9 108,707,185 (GRCm39) missense probably damaging 1.00
R9183:Celsr3 UTSW 9 108,706,595 (GRCm39) missense probably damaging 1.00
R9275:Celsr3 UTSW 9 108,715,689 (GRCm39) missense probably benign 0.27
R9361:Celsr3 UTSW 9 108,726,521 (GRCm39) missense probably damaging 1.00
R9382:Celsr3 UTSW 9 108,706,961 (GRCm39) missense possibly damaging 0.60
R9407:Celsr3 UTSW 9 108,723,596 (GRCm39) missense probably damaging 1.00
R9432:Celsr3 UTSW 9 108,726,032 (GRCm39) missense probably benign 0.00
R9607:Celsr3 UTSW 9 108,717,701 (GRCm39) critical splice donor site probably null
R9626:Celsr3 UTSW 9 108,726,521 (GRCm39) missense probably damaging 1.00
R9628:Celsr3 UTSW 9 108,703,559 (GRCm39) nonsense probably null
R9630:Celsr3 UTSW 9 108,704,296 (GRCm39) missense probably benign
R9645:Celsr3 UTSW 9 108,704,691 (GRCm39) nonsense probably null
R9683:Celsr3 UTSW 9 108,704,522 (GRCm39) missense probably damaging 1.00
R9794:Celsr3 UTSW 9 108,728,502 (GRCm39) missense probably benign 0.00
R9798:Celsr3 UTSW 9 108,705,794 (GRCm39) missense probably damaging 1.00
RF020:Celsr3 UTSW 9 108,726,256 (GRCm39) missense probably benign
X0018:Celsr3 UTSW 9 108,717,611 (GRCm39) missense probably benign 0.01
X0018:Celsr3 UTSW 9 108,704,977 (GRCm39) missense possibly damaging 0.65
X0026:Celsr3 UTSW 9 108,706,129 (GRCm39) missense probably damaging 0.99
Z1177:Celsr3 UTSW 9 108,703,676 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CTGAACTCTTCTCCTAGGCTGG -3'
(R):5'- TGGGGTCAGATGTAGAGGCATC -3'

Sequencing Primer
(F):5'- TCCTAGGCTGGCCTTGC -3'
(R):5'- TCAGATGTAGAGGCATCCCATG -3'
Posted On 2014-06-23