Incidental Mutation 'R1801:Ano10'
ID203152
Institutional Source Beutler Lab
Gene Symbol Ano10
Ensembl Gene ENSMUSG00000037949
Gene Nameanoctamin 10
SynonymsTmem16k
MMRRC Submission 039831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1801 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location122175874-122294423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122253030 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 525 (N525S)
Ref Sequence ENSEMBL: ENSMUSP00000150161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042546] [ENSMUST00000214283] [ENSMUST00000214409] [ENSMUST00000214507] [ENSMUST00000216081] [ENSMUST00000216670]
Predicted Effect probably damaging
Transcript: ENSMUST00000042546
AA Change: N525S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045214
Gene: ENSMUSG00000037949
AA Change: N525S

DomainStartEndE-ValueType
Pfam:Anoctamin 200 628 2.2e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214283
Predicted Effect probably damaging
Transcript: ENSMUST00000214409
AA Change: N467S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214507
AA Change: N333S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216081
Predicted Effect probably damaging
Transcript: ENSMUST00000216670
AA Change: N525S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to inhibit anion conductance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit calcium-activated chloride ion secretion in the jejunum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,396 E362G probably damaging Het
Abcc5 T C 16: 20,338,887 M1307V probably benign Het
Adamts9 A G 6: 92,863,376 V1142A probably benign Het
Bpifa2 T C 2: 154,011,504 probably null Het
C7 C T 15: 5,012,021 V468I possibly damaging Het
Carf A T 1: 60,141,505 H362L possibly damaging Het
Ccdc171 A C 4: 83,546,895 I37L probably benign Het
Ccdc182 T C 11: 88,294,190 L32P possibly damaging Het
Celsr3 A T 9: 108,834,626 D1678V possibly damaging Het
Col7a1 A T 9: 108,960,997 Y920F unknown Het
Cpsf3 T C 12: 21,313,790 V627A probably benign Het
D7Ertd443e A G 7: 134,270,212 M640T probably damaging Het
Ddi2 T C 4: 141,683,972 D543G probably damaging Het
Dnah9 T C 11: 65,955,297 N2972D probably damaging Het
Dnajc18 T C 18: 35,680,804 D304G probably damaging Het
Epg5 T C 18: 77,983,490 V1232A possibly damaging Het
Ezr T C 17: 6,742,372 T358A possibly damaging Het
Filip1 A G 9: 79,815,846 S1164P probably damaging Het
Gm14085 C T 2: 122,521,652 R324C possibly damaging Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gmip T C 8: 69,814,477 V341A probably benign Het
Gnb3 A C 6: 124,835,636 F286V probably benign Het
Gpatch2 T A 1: 187,225,831 S128T probably benign Het
Gpr87 T C 3: 59,179,392 R231G possibly damaging Het
Hip1r G A 5: 123,998,808 R613Q probably benign Het
Hsd3b7 T C 7: 127,803,034 Y284H possibly damaging Het
Il1rap A T 16: 26,698,875 D275V probably damaging Het
Il4 G T 11: 53,618,538 H23Q possibly damaging Het
Kit A G 5: 75,648,393 Y749C probably damaging Het
Klb A G 5: 65,349,235 K275R probably null Het
Klhl12 G T 1: 134,489,070 R510L probably damaging Het
Lrrc8b A G 5: 105,480,823 Y345C probably damaging Het
Med15 T C 16: 17,680,735 T98A possibly damaging Het
Mmp1a T A 9: 7,475,390 Y387N probably damaging Het
Myrf C A 19: 10,214,191 V928L probably benign Het
Nr1d1 T C 11: 98,771,499 K134E probably damaging Het
Nrxn3 A T 12: 90,283,582 D305V probably damaging Het
Obscn A C 11: 58,998,321 S7542A unknown Het
Olfr1197 T A 2: 88,729,264 I112F probably damaging Het
Pak4 G A 7: 28,565,190 R96C probably damaging Het
Papd5 T G 8: 88,250,788 V406G probably benign Het
Pde6b A T 5: 108,427,847 D691V possibly damaging Het
Pdss2 A G 10: 43,345,605 E171G probably benign Het
Pdzd2 C T 15: 12,387,654 V873I possibly damaging Het
Plb1 A T 5: 32,293,243 D376V probably damaging Het
Plekhg1 T C 10: 3,963,904 Y1209H probably damaging Het
Prickle2 A G 6: 92,416,904 C263R probably damaging Het
Psma2 A T 13: 14,623,605 Y104F probably benign Het
Ptger4 T A 15: 5,242,800 M113L possibly damaging Het
Rgs10 T G 7: 128,404,477 D17A possibly damaging Het
Rpap3 A G 15: 97,694,209 S189P possibly damaging Het
Rsbn1 T C 3: 103,914,872 L102P probably damaging Het
Ryr2 T C 13: 11,595,281 S655G probably benign Het
Samd4b A T 7: 28,407,331 probably null Het
Sema4a C T 3: 88,436,749 D732N probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Sh3gl3 C T 7: 82,284,119 T230I possibly damaging Het
Slc5a1 A T 5: 33,146,953 Q299L probably damaging Het
Ssc5d C A 7: 4,936,607 H681N probably benign Het
Sugp2 T C 8: 70,236,710 S10P possibly damaging Het
Supt5 A G 7: 28,317,214 probably null Het
Syna A G 5: 134,560,089 V2A probably benign Het
Tcp1 T A 17: 12,922,202 Y299* probably null Het
Tenm3 C A 8: 48,276,256 V1572L probably benign Het
Trp53rka A G 2: 165,491,613 S119P probably damaging Het
Ubr4 T A 4: 139,452,563 probably null Het
Uchl4 T A 9: 64,235,475 D79E probably benign Het
Vmn2r17 C A 5: 109,428,478 T405K probably damaging Het
Xpnpep1 A G 19: 53,010,133 L228P probably damaging Het
Xrcc4 T G 13: 89,992,579 E170D probably damaging Het
Zfp945 T C 17: 22,851,762 T388A probably damaging Het
Zfp947 G A 17: 22,146,462 A77V probably benign Het
Zkscan5 G A 5: 145,220,205 G433R probably damaging Het
Other mutations in Ano10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Ano10 APN 9 122261356 missense possibly damaging 0.96
IGL00886:Ano10 APN 9 122271324 missense probably benign 0.01
IGL00932:Ano10 APN 9 122251231 nonsense probably null
IGL01613:Ano10 APN 9 122259540 missense possibly damaging 0.75
IGL02109:Ano10 APN 9 122261342 missense probably damaging 1.00
IGL02397:Ano10 APN 9 122261392 missense probably damaging 1.00
IGL02512:Ano10 APN 9 122272474 missense possibly damaging 0.50
IGL03216:Ano10 APN 9 122257061 missense probably damaging 1.00
arna UTSW 9 122259564 missense possibly damaging 0.77
R0624:Ano10 UTSW 9 122259595 splice site probably benign
R1669:Ano10 UTSW 9 122257183 missense possibly damaging 0.94
R2511:Ano10 UTSW 9 122258945 missense probably damaging 0.99
R3836:Ano10 UTSW 9 122263763 missense possibly damaging 0.58
R4027:Ano10 UTSW 9 122252928 splice site probably benign
R4151:Ano10 UTSW 9 122261535 nonsense probably null
R4590:Ano10 UTSW 9 122257165 missense probably benign 0.22
R4651:Ano10 UTSW 9 122261115 nonsense probably null
R4652:Ano10 UTSW 9 122261115 nonsense probably null
R4676:Ano10 UTSW 9 122263787 missense probably damaging 0.98
R5026:Ano10 UTSW 9 122272559 nonsense probably null
R5281:Ano10 UTSW 9 122261486 missense probably damaging 1.00
R5401:Ano10 UTSW 9 122261290 missense probably damaging 1.00
R6269:Ano10 UTSW 9 122261242 missense probably damaging 0.99
R6449:Ano10 UTSW 9 122201688 intron probably benign
R6702:Ano10 UTSW 9 122259564 missense possibly damaging 0.77
R7010:Ano10 UTSW 9 122253124 missense probably damaging 1.00
R7384:Ano10 UTSW 9 122176343 missense unknown
R7584:Ano10 UTSW 9 122275531 missense probably benign
R8849:Ano10 UTSW 9 122261444 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTTTCATGGCAGAGTGTTCC -3'
(R):5'- TGCCCCTTTGCTAGCATTGG -3'

Sequencing Primer
(F):5'- TTCTATAAACAGTGCACACCTGG -3'
(R):5'- GCATTGGCGCGGTTATTCCC -3'
Posted On2014-06-23