Incidental Mutation 'R1801:Plekhg1'
ID 203153
Institutional Source Beutler Lab
Gene Symbol Plekhg1
Ensembl Gene ENSMUSG00000040624
Gene Name pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Synonyms D10Ertd733e
MMRRC Submission 039831-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.252) question?
Stock # R1801 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 3690364-3917303 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3913904 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1209 (Y1209H)
Ref Sequence ENSEMBL: ENSMUSP00000114056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042438] [ENSMUST00000120274]
AlphaFold A0A5F8MPP0
Predicted Effect probably damaging
Transcript: ENSMUST00000042438
AA Change: Y1209H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040495
Gene: ENSMUSG00000040624
AA Change: Y1209H

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
RhoGEF 116 291 4.17e-52 SMART
PH 323 417 2.54e-6 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120274
AA Change: Y1209H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114056
Gene: ENSMUSG00000040624
AA Change: Y1209H

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
RhoGEF 116 291 4.17e-52 SMART
PH 323 417 2.54e-6 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136671
AA Change: Y1264H
SMART Domains Protein: ENSMUSP00000119950
Gene: ENSMUSG00000040624
AA Change: Y1264H

DomainStartEndE-ValueType
low complexity region 67 86 N/A INTRINSIC
RhoGEF 172 347 4.17e-52 SMART
PH 379 473 2.54e-6 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1242 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141367
Predicted Effect unknown
Transcript: ENSMUST00000154727
AA Change: Y1063H
SMART Domains Protein: ENSMUSP00000122131
Gene: ENSMUSG00000040624
AA Change: Y1063H

DomainStartEndE-ValueType
RhoGEF 4 146 2.25e-25 SMART
PH 178 272 2.54e-6 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 1006 1017 N/A INTRINSIC
low complexity region 1041 1052 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI

All alleles(13) : Targeted(2) Gene trapped(11)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,903,230 (GRCm39) E362G probably damaging Het
Abcc5 T C 16: 20,157,637 (GRCm39) M1307V probably benign Het
Adam34l A T 8: 44,078,954 (GRCm39) C423* probably null Het
Adamts9 A G 6: 92,840,357 (GRCm39) V1142A probably benign Het
Ano10 T C 9: 122,082,096 (GRCm39) N525S probably damaging Het
Bpifa2 T C 2: 153,853,424 (GRCm39) probably null Het
C7 C T 15: 5,041,503 (GRCm39) V468I possibly damaging Het
Carf A T 1: 60,180,664 (GRCm39) H362L possibly damaging Het
Ccdc171 A C 4: 83,465,132 (GRCm39) I37L probably benign Het
Ccdc182 T C 11: 88,185,016 (GRCm39) L32P possibly damaging Het
Celsr3 A T 9: 108,711,825 (GRCm39) D1678V possibly damaging Het
Col7a1 A T 9: 108,790,065 (GRCm39) Y920F unknown Het
Cpsf3 T C 12: 21,363,791 (GRCm39) V627A probably benign Het
D7Ertd443e A G 7: 133,871,941 (GRCm39) M640T probably damaging Het
Ddi2 T C 4: 141,411,283 (GRCm39) D543G probably damaging Het
Dnah9 T C 11: 65,846,123 (GRCm39) N2972D probably damaging Het
Dnajc18 T C 18: 35,813,857 (GRCm39) D304G probably damaging Het
Epg5 T C 18: 78,026,705 (GRCm39) V1232A possibly damaging Het
Ezr T C 17: 7,009,771 (GRCm39) T358A possibly damaging Het
Filip1 A G 9: 79,723,128 (GRCm39) S1164P probably damaging Het
Gmip T C 8: 70,267,127 (GRCm39) V341A probably benign Het
Gnb3 A C 6: 124,812,599 (GRCm39) F286V probably benign Het
Gpatch2 T A 1: 186,958,028 (GRCm39) S128T probably benign Het
Gpr87 T C 3: 59,086,813 (GRCm39) R231G possibly damaging Het
Hip1r G A 5: 124,136,871 (GRCm39) R613Q probably benign Het
Hsd3b7 T C 7: 127,402,206 (GRCm39) Y284H possibly damaging Het
Il1rap A T 16: 26,517,625 (GRCm39) D275V probably damaging Het
Il4 G T 11: 53,509,365 (GRCm39) H23Q possibly damaging Het
Kit A G 5: 75,809,053 (GRCm39) Y749C probably damaging Het
Klb A G 5: 65,506,578 (GRCm39) K275R probably null Het
Klhl12 G T 1: 134,416,808 (GRCm39) R510L probably damaging Het
Lrrc8b A G 5: 105,628,689 (GRCm39) Y345C probably damaging Het
Med15 T C 16: 17,498,599 (GRCm39) T98A possibly damaging Het
Mmp1a T A 9: 7,475,391 (GRCm39) Y387N probably damaging Het
Myrf C A 19: 10,191,555 (GRCm39) V928L probably benign Het
Nr1d1 T C 11: 98,662,325 (GRCm39) K134E probably damaging Het
Nrxn3 A T 12: 90,250,356 (GRCm39) D305V probably damaging Het
Obscn A C 11: 58,889,147 (GRCm39) S7542A unknown Het
Or4a27 T A 2: 88,559,608 (GRCm39) I112F probably damaging Het
Pak4 G A 7: 28,264,615 (GRCm39) R96C probably damaging Het
Pde6b A T 5: 108,575,713 (GRCm39) D691V possibly damaging Het
Pdss2 A G 10: 43,221,601 (GRCm39) E171G probably benign Het
Pdzd2 C T 15: 12,387,740 (GRCm39) V873I possibly damaging Het
Plb1 A T 5: 32,450,587 (GRCm39) D376V probably damaging Het
Prickle2 A G 6: 92,393,885 (GRCm39) C263R probably damaging Het
Psma2 A T 13: 14,798,190 (GRCm39) Y104F probably benign Het
Ptger4 T A 15: 5,272,281 (GRCm39) M113L possibly damaging Het
Rgs10 T G 7: 128,006,201 (GRCm39) D17A possibly damaging Het
Rpap3 A G 15: 97,592,090 (GRCm39) S189P possibly damaging Het
Rsbn1 T C 3: 103,822,188 (GRCm39) L102P probably damaging Het
Ryr2 T C 13: 11,610,167 (GRCm39) S655G probably benign Het
Samd4b A T 7: 28,106,756 (GRCm39) probably null Het
Sema4a C T 3: 88,344,056 (GRCm39) D732N probably benign Het
Sh3bp5l A G 11: 58,237,177 (GRCm39) D378G probably benign Het
Sh3gl3 C T 7: 81,933,327 (GRCm39) T230I possibly damaging Het
Slc28a2b C T 2: 122,352,133 (GRCm39) R324C possibly damaging Het
Slc5a1 A T 5: 33,304,297 (GRCm39) Q299L probably damaging Het
Ssc5d C A 7: 4,939,606 (GRCm39) H681N probably benign Het
Sugp2 T C 8: 70,689,360 (GRCm39) S10P possibly damaging Het
Supt5 A G 7: 28,016,639 (GRCm39) probably null Het
Syna A G 5: 134,588,943 (GRCm39) V2A probably benign Het
Tcp1 T A 17: 13,141,089 (GRCm39) Y299* probably null Het
Tenm3 C A 8: 48,729,291 (GRCm39) V1572L probably benign Het
Tent4b T G 8: 88,977,416 (GRCm39) V406G probably benign Het
Trp53rka A G 2: 165,333,533 (GRCm39) S119P probably damaging Het
Ubr4 T A 4: 139,179,874 (GRCm39) probably null Het
Uchl4 T A 9: 64,142,757 (GRCm39) D79E probably benign Het
Vmn2r17 C A 5: 109,576,344 (GRCm39) T405K probably damaging Het
Xpnpep1 A G 19: 52,998,564 (GRCm39) L228P probably damaging Het
Xrcc4 T G 13: 90,140,698 (GRCm39) E170D probably damaging Het
Zfp945 T C 17: 23,070,736 (GRCm39) T388A probably damaging Het
Zfp947 G A 17: 22,365,443 (GRCm39) A77V probably benign Het
Zkscan5 G A 5: 145,157,015 (GRCm39) G433R probably damaging Het
Other mutations in Plekhg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Plekhg1 APN 10 3,913,631 (GRCm39) missense probably benign 0.02
IGL01639:Plekhg1 APN 10 3,906,751 (GRCm39) missense probably damaging 0.98
IGL01766:Plekhg1 APN 10 3,823,400 (GRCm39) missense probably damaging 1.00
IGL01983:Plekhg1 APN 10 3,895,904 (GRCm39) missense probably damaging 1.00
IGL02226:Plekhg1 APN 10 3,895,916 (GRCm39) missense probably damaging 0.99
IGL02420:Plekhg1 APN 10 3,914,106 (GRCm39) missense probably damaging 1.00
IGL02441:Plekhg1 APN 10 3,908,103 (GRCm39) missense possibly damaging 0.89
IGL02505:Plekhg1 APN 10 3,907,139 (GRCm39) missense probably damaging 0.97
IGL02659:Plekhg1 APN 10 3,907,069 (GRCm39) nonsense probably null
IGL02730:Plekhg1 APN 10 3,823,242 (GRCm39) missense possibly damaging 0.59
BB006:Plekhg1 UTSW 10 3,869,170 (GRCm39) missense probably damaging 0.99
BB016:Plekhg1 UTSW 10 3,869,170 (GRCm39) missense probably damaging 0.99
PIT4453001:Plekhg1 UTSW 10 3,913,469 (GRCm39) missense
R0041:Plekhg1 UTSW 10 3,914,076 (GRCm39) nonsense probably null
R0041:Plekhg1 UTSW 10 3,914,074 (GRCm39) missense probably benign 0.02
R0068:Plekhg1 UTSW 10 3,890,504 (GRCm39) nonsense probably null
R0068:Plekhg1 UTSW 10 3,890,502 (GRCm39) missense probably damaging 0.99
R0333:Plekhg1 UTSW 10 3,914,419 (GRCm39) missense probably damaging 1.00
R0427:Plekhg1 UTSW 10 3,914,235 (GRCm39) missense probably benign 0.01
R0499:Plekhg1 UTSW 10 3,887,971 (GRCm39) missense probably damaging 1.00
R0504:Plekhg1 UTSW 10 3,887,853 (GRCm39) missense probably damaging 1.00
R1499:Plekhg1 UTSW 10 3,890,538 (GRCm39) splice site probably benign
R1501:Plekhg1 UTSW 10 3,907,361 (GRCm39) missense probably benign 0.02
R1565:Plekhg1 UTSW 10 3,890,526 (GRCm39) missense probably damaging 1.00
R1823:Plekhg1 UTSW 10 3,853,658 (GRCm39) critical splice donor site probably null
R1858:Plekhg1 UTSW 10 3,895,917 (GRCm39) missense possibly damaging 0.95
R1984:Plekhg1 UTSW 10 3,908,181 (GRCm39) missense probably damaging 1.00
R2420:Plekhg1 UTSW 10 3,908,048 (GRCm39) missense probably benign 0.39
R2421:Plekhg1 UTSW 10 3,908,048 (GRCm39) missense probably benign 0.39
R2422:Plekhg1 UTSW 10 3,908,048 (GRCm39) missense probably benign 0.39
R2437:Plekhg1 UTSW 10 3,913,564 (GRCm39) missense probably damaging 1.00
R2872:Plekhg1 UTSW 10 3,913,982 (GRCm39) missense probably benign
R2872:Plekhg1 UTSW 10 3,913,982 (GRCm39) missense probably benign
R3830:Plekhg1 UTSW 10 3,823,400 (GRCm39) missense probably damaging 1.00
R4058:Plekhg1 UTSW 10 3,907,087 (GRCm39) missense probably damaging 1.00
R4059:Plekhg1 UTSW 10 3,907,087 (GRCm39) missense probably damaging 1.00
R4649:Plekhg1 UTSW 10 3,906,985 (GRCm39) missense probably benign 0.00
R4731:Plekhg1 UTSW 10 3,907,506 (GRCm39) missense probably benign 0.01
R4732:Plekhg1 UTSW 10 3,907,506 (GRCm39) missense probably benign 0.01
R4733:Plekhg1 UTSW 10 3,907,506 (GRCm39) missense probably benign 0.01
R4772:Plekhg1 UTSW 10 3,823,130 (GRCm39) missense probably damaging 1.00
R4772:Plekhg1 UTSW 10 3,823,127 (GRCm39) missense probably benign 0.00
R4803:Plekhg1 UTSW 10 3,907,186 (GRCm39) missense probably benign 0.02
R5086:Plekhg1 UTSW 10 3,853,649 (GRCm39) missense probably damaging 1.00
R5175:Plekhg1 UTSW 10 3,915,516 (GRCm39) unclassified probably benign
R5283:Plekhg1 UTSW 10 3,906,654 (GRCm39) missense probably benign 0.00
R5862:Plekhg1 UTSW 10 3,887,914 (GRCm39) missense probably damaging 1.00
R6163:Plekhg1 UTSW 10 3,914,369 (GRCm39) missense probably damaging 1.00
R6564:Plekhg1 UTSW 10 3,914,153 (GRCm39) missense probably damaging 1.00
R6700:Plekhg1 UTSW 10 3,907,373 (GRCm39) missense probably benign
R6930:Plekhg1 UTSW 10 3,913,770 (GRCm39) missense possibly damaging 0.56
R7033:Plekhg1 UTSW 10 3,890,251 (GRCm39) missense probably damaging 0.97
R7200:Plekhg1 UTSW 10 3,906,810 (GRCm39) missense
R7223:Plekhg1 UTSW 10 3,823,343 (GRCm39) missense
R7353:Plekhg1 UTSW 10 3,914,327 (GRCm39) missense
R7488:Plekhg1 UTSW 10 3,907,491 (GRCm39) missense
R7554:Plekhg1 UTSW 10 3,913,647 (GRCm39) missense
R7929:Plekhg1 UTSW 10 3,869,170 (GRCm39) missense probably damaging 0.99
R8014:Plekhg1 UTSW 10 3,907,758 (GRCm39) missense
R8104:Plekhg1 UTSW 10 3,902,326 (GRCm39) missense
R8167:Plekhg1 UTSW 10 3,907,453 (GRCm39) missense
R8167:Plekhg1 UTSW 10 3,907,452 (GRCm39) missense
R8215:Plekhg1 UTSW 10 3,907,521 (GRCm39) missense
R8263:Plekhg1 UTSW 10 3,907,651 (GRCm39) missense
R8682:Plekhg1 UTSW 10 3,897,523 (GRCm39) missense
R8746:Plekhg1 UTSW 10 3,907,777 (GRCm39) missense
R9148:Plekhg1 UTSW 10 3,907,527 (GRCm39) missense
R9220:Plekhg1 UTSW 10 3,913,805 (GRCm39) missense
R9245:Plekhg1 UTSW 10 3,907,141 (GRCm39) missense
R9520:Plekhg1 UTSW 10 3,906,822 (GRCm39) missense
R9778:Plekhg1 UTSW 10 3,887,966 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ATTAGGCCCAGGCAGTTGTC -3'
(R):5'- TGAGCGCTTAAGGGTAAATTTC -3'

Sequencing Primer
(F):5'- GTCTCTCCAAGTGTCGGAC -3'
(R):5'- CTATTTACCACGAGAACCTTCTGCG -3'
Posted On 2014-06-23