Incidental Mutation 'R1801:2610008E11Rik'
ID203156
Institutional Source Beutler Lab
Gene Symbol 2610008E11Rik
Ensembl Gene ENSMUSG00000060301
Gene NameRIKEN cDNA 2610008E11 gene
Synonyms
MMRRC Submission 039831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1801 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79064374-79097600 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79067396 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 362 (E362G)
Ref Sequence ENSEMBL: ENSMUSP00000044020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039271] [ENSMUST00000218854] [ENSMUST00000220220]
Predicted Effect probably damaging
Transcript: ENSMUST00000039271
AA Change: E362G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044020
Gene: ENSMUSG00000060301
AA Change: E362G

DomainStartEndE-ValueType
KRAB 10 70 6.95e-32 SMART
ZnF_C2H2 215 237 1.61e2 SMART
ZnF_C2H2 243 266 4.24e-4 SMART
ZnF_C2H2 272 295 1.03e-2 SMART
ZnF_C2H2 301 324 1.76e-1 SMART
ZnF_C2H2 330 352 1.45e-2 SMART
ZnF_C2H2 358 380 1.58e-3 SMART
ZnF_C2H2 386 408 2.75e-3 SMART
ZnF_C2H2 414 437 4.61e-5 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 5.81e-2 SMART
ZnF_C2H2 499 521 4.79e-3 SMART
ZnF_C2H2 527 549 3.58e-2 SMART
ZnF_C2H2 555 577 3.44e-4 SMART
ZnF_C2H2 583 605 6.78e-3 SMART
ZnF_C2H2 611 633 3.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218854
Predicted Effect probably benign
Transcript: ENSMUST00000220220
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,338,887 M1307V probably benign Het
Adamts9 A G 6: 92,863,376 V1142A probably benign Het
Ano10 T C 9: 122,253,030 N525S probably damaging Het
Bpifa2 T C 2: 154,011,504 probably null Het
C7 C T 15: 5,012,021 V468I possibly damaging Het
Carf A T 1: 60,141,505 H362L possibly damaging Het
Ccdc171 A C 4: 83,546,895 I37L probably benign Het
Ccdc182 T C 11: 88,294,190 L32P possibly damaging Het
Celsr3 A T 9: 108,834,626 D1678V possibly damaging Het
Col7a1 A T 9: 108,960,997 Y920F unknown Het
Cpsf3 T C 12: 21,313,790 V627A probably benign Het
D7Ertd443e A G 7: 134,270,212 M640T probably damaging Het
Ddi2 T C 4: 141,683,972 D543G probably damaging Het
Dnah9 T C 11: 65,955,297 N2972D probably damaging Het
Dnajc18 T C 18: 35,680,804 D304G probably damaging Het
Epg5 T C 18: 77,983,490 V1232A possibly damaging Het
Ezr T C 17: 6,742,372 T358A possibly damaging Het
Filip1 A G 9: 79,815,846 S1164P probably damaging Het
Gm14085 C T 2: 122,521,652 R324C possibly damaging Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gmip T C 8: 69,814,477 V341A probably benign Het
Gnb3 A C 6: 124,835,636 F286V probably benign Het
Gpatch2 T A 1: 187,225,831 S128T probably benign Het
Gpr87 T C 3: 59,179,392 R231G possibly damaging Het
Hip1r G A 5: 123,998,808 R613Q probably benign Het
Hsd3b7 T C 7: 127,803,034 Y284H possibly damaging Het
Il1rap A T 16: 26,698,875 D275V probably damaging Het
Il4 G T 11: 53,618,538 H23Q possibly damaging Het
Kit A G 5: 75,648,393 Y749C probably damaging Het
Klb A G 5: 65,349,235 K275R probably null Het
Klhl12 G T 1: 134,489,070 R510L probably damaging Het
Lrrc8b A G 5: 105,480,823 Y345C probably damaging Het
Med15 T C 16: 17,680,735 T98A possibly damaging Het
Mmp1a T A 9: 7,475,390 Y387N probably damaging Het
Myrf C A 19: 10,214,191 V928L probably benign Het
Nr1d1 T C 11: 98,771,499 K134E probably damaging Het
Nrxn3 A T 12: 90,283,582 D305V probably damaging Het
Obscn A C 11: 58,998,321 S7542A unknown Het
Olfr1197 T A 2: 88,729,264 I112F probably damaging Het
Pak4 G A 7: 28,565,190 R96C probably damaging Het
Papd5 T G 8: 88,250,788 V406G probably benign Het
Pde6b A T 5: 108,427,847 D691V possibly damaging Het
Pdss2 A G 10: 43,345,605 E171G probably benign Het
Pdzd2 C T 15: 12,387,654 V873I possibly damaging Het
Plb1 A T 5: 32,293,243 D376V probably damaging Het
Plekhg1 T C 10: 3,963,904 Y1209H probably damaging Het
Prickle2 A G 6: 92,416,904 C263R probably damaging Het
Psma2 A T 13: 14,623,605 Y104F probably benign Het
Ptger4 T A 15: 5,242,800 M113L possibly damaging Het
Rgs10 T G 7: 128,404,477 D17A possibly damaging Het
Rpap3 A G 15: 97,694,209 S189P possibly damaging Het
Rsbn1 T C 3: 103,914,872 L102P probably damaging Het
Ryr2 T C 13: 11,595,281 S655G probably benign Het
Samd4b A T 7: 28,407,331 probably null Het
Sema4a C T 3: 88,436,749 D732N probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Sh3gl3 C T 7: 82,284,119 T230I possibly damaging Het
Slc5a1 A T 5: 33,146,953 Q299L probably damaging Het
Ssc5d C A 7: 4,936,607 H681N probably benign Het
Sugp2 T C 8: 70,236,710 S10P possibly damaging Het
Supt5 A G 7: 28,317,214 probably null Het
Syna A G 5: 134,560,089 V2A probably benign Het
Tcp1 T A 17: 12,922,202 Y299* probably null Het
Tenm3 C A 8: 48,276,256 V1572L probably benign Het
Trp53rka A G 2: 165,491,613 S119P probably damaging Het
Ubr4 T A 4: 139,452,563 probably null Het
Uchl4 T A 9: 64,235,475 D79E probably benign Het
Vmn2r17 C A 5: 109,428,478 T405K probably damaging Het
Xpnpep1 A G 19: 53,010,133 L228P probably damaging Het
Xrcc4 T G 13: 89,992,579 E170D probably damaging Het
Zfp945 T C 17: 22,851,762 T388A probably damaging Het
Zfp947 G A 17: 22,146,462 A77V probably benign Het
Zkscan5 G A 5: 145,220,205 G433R probably damaging Het
Other mutations in 2610008E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:2610008E11Rik APN 10 79088313 missense possibly damaging 0.79
IGL01905:2610008E11Rik APN 10 79067748 missense probably damaging 1.00
IGL02522:2610008E11Rik APN 10 79067799 missense probably benign 0.27
IGL02999:2610008E11Rik APN 10 79067590 missense possibly damaging 0.74
K7371:2610008E11Rik UTSW 10 79067933 missense probably benign 0.01
R0557:2610008E11Rik UTSW 10 79067685 missense probably damaging 0.99
R0761:2610008E11Rik UTSW 10 79067999 missense probably benign 0.00
R1528:2610008E11Rik UTSW 10 79067696 missense possibly damaging 0.72
R1923:2610008E11Rik UTSW 10 79067909 missense probably damaging 0.98
R2444:2610008E11Rik UTSW 10 79068727 missense possibly damaging 0.95
R4223:2610008E11Rik UTSW 10 79094452 missense probably damaging 1.00
R4653:2610008E11Rik UTSW 10 79067430 missense probably benign 0.42
R5127:2610008E11Rik UTSW 10 79066992 missense probably damaging 1.00
R5784:2610008E11Rik UTSW 10 79067607 missense possibly damaging 0.68
R6175:2610008E11Rik UTSW 10 79066614 missense probably damaging 0.98
R6990:2610008E11Rik UTSW 10 79067091 missense probably damaging 0.99
R7055:2610008E11Rik UTSW 10 79067847 missense probably damaging 0.98
R7133:2610008E11Rik UTSW 10 79066639 missense probably benign 0.02
R7133:2610008E11Rik UTSW 10 79066640 missense probably benign 0.33
R7142:2610008E11Rik UTSW 10 79067612 missense probably damaging 1.00
R7382:2610008E11Rik UTSW 10 79067269 missense probably damaging 1.00
R7577:2610008E11Rik UTSW 10 79066491 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GATGCTCAGTGAGATTTGACTTAG -3'
(R):5'- ACCCTACGAATGTGTAGAATGC -3'

Sequencing Primer
(F):5'- GCTCAGTGAGATTTGACTTAGAATTG -3'
(R):5'- GCAGTAAGACTTTCTACTGTAAGTC -3'
Posted On2014-06-23