Incidental Mutation 'R1801:Cpsf3'
ID203165
Institutional Source Beutler Lab
Gene Symbol Cpsf3
Ensembl Gene ENSMUSG00000054309
Gene Namecleavage and polyadenylation specificity factor 3
Synonyms73 kDa
MMRRC Submission 039831-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1801 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location21285391-21315056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21313790 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 627 (V627A)
Ref Sequence ENSEMBL: ENSMUSP00000068148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067284] [ENSMUST00000076813] [ENSMUST00000221693] [ENSMUST00000223345]
Predicted Effect probably benign
Transcript: ENSMUST00000067284
AA Change: V627A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000068148
Gene: ENSMUSG00000054309
AA Change: V627A

DomainStartEndE-ValueType
Lactamase_B 24 234 8.27e-12 SMART
Beta-Casp 246 367 7.32e-45 SMART
Pfam:RMMBL 380 422 9.9e-17 PFAM
CPSF73-100_C 477 683 6.78e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076813
SMART Domains Protein: ENSMUSP00000076090
Gene: ENSMUSG00000062054

DomainStartEndE-ValueType
Pfam:Lipase_GDSL 18 213 1.3e-34 PFAM
Pfam:Lipase_GDSL_2 19 209 2.8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220940
Predicted Effect probably benign
Transcript: ENSMUST00000221042
Predicted Effect probably benign
Transcript: ENSMUST00000221693
Predicted Effect probably benign
Transcript: ENSMUST00000222344
Predicted Effect probably benign
Transcript: ENSMUST00000223345
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the metallo-beta-lactamase family. The encoded protein is a 73kDa subunit of the cleavage and polyadenylation specificity factor and functions as an endonuclease that recognizes the pre-mRNA 3'-cleavage site AAUAAA prior to polyadenylation. It also cleaves after the pre-mRNA sequence ACCCA during histone 3'-end pre-mRNA processing. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,396 E362G probably damaging Het
Abcc5 T C 16: 20,338,887 M1307V probably benign Het
Adamts9 A G 6: 92,863,376 V1142A probably benign Het
Ano10 T C 9: 122,253,030 N525S probably damaging Het
Bpifa2 T C 2: 154,011,504 probably null Het
C7 C T 15: 5,012,021 V468I possibly damaging Het
Carf A T 1: 60,141,505 H362L possibly damaging Het
Ccdc171 A C 4: 83,546,895 I37L probably benign Het
Ccdc182 T C 11: 88,294,190 L32P possibly damaging Het
Celsr3 A T 9: 108,834,626 D1678V possibly damaging Het
Col7a1 A T 9: 108,960,997 Y920F unknown Het
D7Ertd443e A G 7: 134,270,212 M640T probably damaging Het
Ddi2 T C 4: 141,683,972 D543G probably damaging Het
Dnah9 T C 11: 65,955,297 N2972D probably damaging Het
Dnajc18 T C 18: 35,680,804 D304G probably damaging Het
Epg5 T C 18: 77,983,490 V1232A possibly damaging Het
Ezr T C 17: 6,742,372 T358A possibly damaging Het
Filip1 A G 9: 79,815,846 S1164P probably damaging Het
Gm14085 C T 2: 122,521,652 R324C possibly damaging Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gmip T C 8: 69,814,477 V341A probably benign Het
Gnb3 A C 6: 124,835,636 F286V probably benign Het
Gpatch2 T A 1: 187,225,831 S128T probably benign Het
Gpr87 T C 3: 59,179,392 R231G possibly damaging Het
Hip1r G A 5: 123,998,808 R613Q probably benign Het
Hsd3b7 T C 7: 127,803,034 Y284H possibly damaging Het
Il1rap A T 16: 26,698,875 D275V probably damaging Het
Il4 G T 11: 53,618,538 H23Q possibly damaging Het
Kit A G 5: 75,648,393 Y749C probably damaging Het
Klb A G 5: 65,349,235 K275R probably null Het
Klhl12 G T 1: 134,489,070 R510L probably damaging Het
Lrrc8b A G 5: 105,480,823 Y345C probably damaging Het
Med15 T C 16: 17,680,735 T98A possibly damaging Het
Mmp1a T A 9: 7,475,390 Y387N probably damaging Het
Myrf C A 19: 10,214,191 V928L probably benign Het
Nr1d1 T C 11: 98,771,499 K134E probably damaging Het
Nrxn3 A T 12: 90,283,582 D305V probably damaging Het
Obscn A C 11: 58,998,321 S7542A unknown Het
Olfr1197 T A 2: 88,729,264 I112F probably damaging Het
Pak4 G A 7: 28,565,190 R96C probably damaging Het
Papd5 T G 8: 88,250,788 V406G probably benign Het
Pde6b A T 5: 108,427,847 D691V possibly damaging Het
Pdss2 A G 10: 43,345,605 E171G probably benign Het
Pdzd2 C T 15: 12,387,654 V873I possibly damaging Het
Plb1 A T 5: 32,293,243 D376V probably damaging Het
Plekhg1 T C 10: 3,963,904 Y1209H probably damaging Het
Prickle2 A G 6: 92,416,904 C263R probably damaging Het
Psma2 A T 13: 14,623,605 Y104F probably benign Het
Ptger4 T A 15: 5,242,800 M113L possibly damaging Het
Rgs10 T G 7: 128,404,477 D17A possibly damaging Het
Rpap3 A G 15: 97,694,209 S189P possibly damaging Het
Rsbn1 T C 3: 103,914,872 L102P probably damaging Het
Ryr2 T C 13: 11,595,281 S655G probably benign Het
Samd4b A T 7: 28,407,331 probably null Het
Sema4a C T 3: 88,436,749 D732N probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Sh3gl3 C T 7: 82,284,119 T230I possibly damaging Het
Slc5a1 A T 5: 33,146,953 Q299L probably damaging Het
Ssc5d C A 7: 4,936,607 H681N probably benign Het
Sugp2 T C 8: 70,236,710 S10P possibly damaging Het
Supt5 A G 7: 28,317,214 probably null Het
Syna A G 5: 134,560,089 V2A probably benign Het
Tcp1 T A 17: 12,922,202 Y299* probably null Het
Tenm3 C A 8: 48,276,256 V1572L probably benign Het
Trp53rka A G 2: 165,491,613 S119P probably damaging Het
Ubr4 T A 4: 139,452,563 probably null Het
Uchl4 T A 9: 64,235,475 D79E probably benign Het
Vmn2r17 C A 5: 109,428,478 T405K probably damaging Het
Xpnpep1 A G 19: 53,010,133 L228P probably damaging Het
Xrcc4 T G 13: 89,992,579 E170D probably damaging Het
Zfp945 T C 17: 22,851,762 T388A probably damaging Het
Zfp947 G A 17: 22,146,462 A77V probably benign Het
Zkscan5 G A 5: 145,220,205 G433R probably damaging Het
Other mutations in Cpsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Cpsf3 APN 12 21301456 missense probably damaging 1.00
IGL02192:Cpsf3 APN 12 21310193 unclassified probably benign
IGL02192:Cpsf3 APN 12 21310196 critical splice acceptor site probably null
IGL02651:Cpsf3 APN 12 21293297 missense probably damaging 1.00
IGL02963:Cpsf3 APN 12 21302422 missense probably damaging 0.99
IGL03072:Cpsf3 APN 12 21295088 missense possibly damaging 0.83
IGL03307:Cpsf3 APN 12 21296714 missense possibly damaging 0.87
IGL03335:Cpsf3 APN 12 21306887 splice site probably null
R0419:Cpsf3 UTSW 12 21297799 missense probably damaging 1.00
R0441:Cpsf3 UTSW 12 21300084 missense probably damaging 1.00
R1669:Cpsf3 UTSW 12 21305331 missense probably damaging 1.00
R1797:Cpsf3 UTSW 12 21306850 missense probably benign 0.01
R1860:Cpsf3 UTSW 12 21296732 missense probably damaging 1.00
R3782:Cpsf3 UTSW 12 21300066 missense possibly damaging 0.83
R3953:Cpsf3 UTSW 12 21313805 missense probably benign
R3954:Cpsf3 UTSW 12 21313805 missense probably benign
R3955:Cpsf3 UTSW 12 21313805 missense probably benign
R3957:Cpsf3 UTSW 12 21313805 missense probably benign
R4922:Cpsf3 UTSW 12 21301537 missense probably damaging 1.00
R5112:Cpsf3 UTSW 12 21291784 missense probably benign
R5363:Cpsf3 UTSW 12 21308985 missense probably benign 0.00
R5507:Cpsf3 UTSW 12 21297928 missense probably damaging 1.00
R6090:Cpsf3 UTSW 12 21295193 missense probably damaging 0.99
R6144:Cpsf3 UTSW 12 21306886 splice site probably null
R6238:Cpsf3 UTSW 12 21300162 missense probably damaging 1.00
R7229:Cpsf3 UTSW 12 21296737 critical splice donor site probably null
X0060:Cpsf3 UTSW 12 21302392 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACCAGTACAGCACTCTCGTG -3'
(R):5'- AAGGCTTCGTTCCACTAAGG -3'

Sequencing Primer
(F):5'- TACAGCACTCTCGTGGGTCG -3'
(R):5'- TCGTTCCACTAAGGCACTCAC -3'
Posted On2014-06-23