Incidental Mutation 'R1801:Ptger4'
ID 203171
Institutional Source Beutler Lab
Gene Symbol Ptger4
Ensembl Gene ENSMUSG00000039942
Gene Name prostaglandin E receptor 4 (subtype EP4)
Synonyms Ptgerep4, EP4
MMRRC Submission 039831-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.180) question?
Stock # R1801 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 5262880-5273668 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5272281 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 113 (M113L)
Ref Sequence ENSEMBL: ENSMUSP00000112858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047379] [ENSMUST00000120563]
AlphaFold P32240
Predicted Effect possibly damaging
Transcript: ENSMUST00000047379
AA Change: M138L

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048736
Gene: ENSMUSG00000039942
AA Change: M138L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 258 1.3e-7 PFAM
Pfam:7tm_1 59 357 1.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120563
AA Change: M113L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112858
Gene: ENSMUSG00000039942
AA Change: M113L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 25 233 1.9e-7 PFAM
Pfam:7tm_1 34 332 8.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133966
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor can activate T-cell factor signaling. It has been shown to mediate PGE2 induced expression of early growth response 1 (EGR1), regulate the level and stability of cyclooxygenase-2 mRNA, and lead to the phosphorylation of glycogen synthase kinase-3. Knockout studies in mice suggest that this receptor may be involved in the neonatal adaptation of circulatory system, osteoporosis, as well as initiation of skin immune responses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous targeted null mutants die shortly after birth due to failed closure of the ductus arteriosis. Survivors show decreased migration of Langerhans cells to lymph nodes, contact hypersensitivity and decreased incidence of induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,903,230 (GRCm39) E362G probably damaging Het
Abcc5 T C 16: 20,157,637 (GRCm39) M1307V probably benign Het
Adam34l A T 8: 44,078,954 (GRCm39) C423* probably null Het
Adamts9 A G 6: 92,840,357 (GRCm39) V1142A probably benign Het
Ano10 T C 9: 122,082,096 (GRCm39) N525S probably damaging Het
Bpifa2 T C 2: 153,853,424 (GRCm39) probably null Het
C7 C T 15: 5,041,503 (GRCm39) V468I possibly damaging Het
Carf A T 1: 60,180,664 (GRCm39) H362L possibly damaging Het
Ccdc171 A C 4: 83,465,132 (GRCm39) I37L probably benign Het
Ccdc182 T C 11: 88,185,016 (GRCm39) L32P possibly damaging Het
Celsr3 A T 9: 108,711,825 (GRCm39) D1678V possibly damaging Het
Col7a1 A T 9: 108,790,065 (GRCm39) Y920F unknown Het
Cpsf3 T C 12: 21,363,791 (GRCm39) V627A probably benign Het
D7Ertd443e A G 7: 133,871,941 (GRCm39) M640T probably damaging Het
Ddi2 T C 4: 141,411,283 (GRCm39) D543G probably damaging Het
Dnah9 T C 11: 65,846,123 (GRCm39) N2972D probably damaging Het
Dnajc18 T C 18: 35,813,857 (GRCm39) D304G probably damaging Het
Epg5 T C 18: 78,026,705 (GRCm39) V1232A possibly damaging Het
Ezr T C 17: 7,009,771 (GRCm39) T358A possibly damaging Het
Filip1 A G 9: 79,723,128 (GRCm39) S1164P probably damaging Het
Gmip T C 8: 70,267,127 (GRCm39) V341A probably benign Het
Gnb3 A C 6: 124,812,599 (GRCm39) F286V probably benign Het
Gpatch2 T A 1: 186,958,028 (GRCm39) S128T probably benign Het
Gpr87 T C 3: 59,086,813 (GRCm39) R231G possibly damaging Het
Hip1r G A 5: 124,136,871 (GRCm39) R613Q probably benign Het
Hsd3b7 T C 7: 127,402,206 (GRCm39) Y284H possibly damaging Het
Il1rap A T 16: 26,517,625 (GRCm39) D275V probably damaging Het
Il4 G T 11: 53,509,365 (GRCm39) H23Q possibly damaging Het
Kit A G 5: 75,809,053 (GRCm39) Y749C probably damaging Het
Klb A G 5: 65,506,578 (GRCm39) K275R probably null Het
Klhl12 G T 1: 134,416,808 (GRCm39) R510L probably damaging Het
Lrrc8b A G 5: 105,628,689 (GRCm39) Y345C probably damaging Het
Med15 T C 16: 17,498,599 (GRCm39) T98A possibly damaging Het
Mmp1a T A 9: 7,475,391 (GRCm39) Y387N probably damaging Het
Myrf C A 19: 10,191,555 (GRCm39) V928L probably benign Het
Nr1d1 T C 11: 98,662,325 (GRCm39) K134E probably damaging Het
Nrxn3 A T 12: 90,250,356 (GRCm39) D305V probably damaging Het
Obscn A C 11: 58,889,147 (GRCm39) S7542A unknown Het
Or4a27 T A 2: 88,559,608 (GRCm39) I112F probably damaging Het
Pak4 G A 7: 28,264,615 (GRCm39) R96C probably damaging Het
Pde6b A T 5: 108,575,713 (GRCm39) D691V possibly damaging Het
Pdss2 A G 10: 43,221,601 (GRCm39) E171G probably benign Het
Pdzd2 C T 15: 12,387,740 (GRCm39) V873I possibly damaging Het
Plb1 A T 5: 32,450,587 (GRCm39) D376V probably damaging Het
Plekhg1 T C 10: 3,913,904 (GRCm39) Y1209H probably damaging Het
Prickle2 A G 6: 92,393,885 (GRCm39) C263R probably damaging Het
Psma2 A T 13: 14,798,190 (GRCm39) Y104F probably benign Het
Rgs10 T G 7: 128,006,201 (GRCm39) D17A possibly damaging Het
Rpap3 A G 15: 97,592,090 (GRCm39) S189P possibly damaging Het
Rsbn1 T C 3: 103,822,188 (GRCm39) L102P probably damaging Het
Ryr2 T C 13: 11,610,167 (GRCm39) S655G probably benign Het
Samd4b A T 7: 28,106,756 (GRCm39) probably null Het
Sema4a C T 3: 88,344,056 (GRCm39) D732N probably benign Het
Sh3bp5l A G 11: 58,237,177 (GRCm39) D378G probably benign Het
Sh3gl3 C T 7: 81,933,327 (GRCm39) T230I possibly damaging Het
Slc28a2b C T 2: 122,352,133 (GRCm39) R324C possibly damaging Het
Slc5a1 A T 5: 33,304,297 (GRCm39) Q299L probably damaging Het
Ssc5d C A 7: 4,939,606 (GRCm39) H681N probably benign Het
Sugp2 T C 8: 70,689,360 (GRCm39) S10P possibly damaging Het
Supt5 A G 7: 28,016,639 (GRCm39) probably null Het
Syna A G 5: 134,588,943 (GRCm39) V2A probably benign Het
Tcp1 T A 17: 13,141,089 (GRCm39) Y299* probably null Het
Tenm3 C A 8: 48,729,291 (GRCm39) V1572L probably benign Het
Tent4b T G 8: 88,977,416 (GRCm39) V406G probably benign Het
Trp53rka A G 2: 165,333,533 (GRCm39) S119P probably damaging Het
Ubr4 T A 4: 139,179,874 (GRCm39) probably null Het
Uchl4 T A 9: 64,142,757 (GRCm39) D79E probably benign Het
Vmn2r17 C A 5: 109,576,344 (GRCm39) T405K probably damaging Het
Xpnpep1 A G 19: 52,998,564 (GRCm39) L228P probably damaging Het
Xrcc4 T G 13: 90,140,698 (GRCm39) E170D probably damaging Het
Zfp945 T C 17: 23,070,736 (GRCm39) T388A probably damaging Het
Zfp947 G A 17: 22,365,443 (GRCm39) A77V probably benign Het
Zkscan5 G A 5: 145,157,015 (GRCm39) G433R probably damaging Het
Other mutations in Ptger4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Ptger4 APN 15 5,272,614 (GRCm39) missense probably benign 0.00
IGL00848:Ptger4 APN 15 5,264,589 (GRCm39) missense probably benign 0.16
IGL01309:Ptger4 APN 15 5,272,239 (GRCm39) missense probably damaging 1.00
IGL02083:Ptger4 APN 15 5,272,655 (GRCm39) missense probably benign 0.00
IGL03245:Ptger4 APN 15 5,264,588 (GRCm39) missense probably damaging 1.00
R0369:Ptger4 UTSW 15 5,272,491 (GRCm39) missense probably benign 0.06
R0427:Ptger4 UTSW 15 5,272,382 (GRCm39) missense probably benign 0.25
R1399:Ptger4 UTSW 15 5,264,412 (GRCm39) missense possibly damaging 0.81
R1778:Ptger4 UTSW 15 5,264,576 (GRCm39) missense probably damaging 1.00
R2089:Ptger4 UTSW 15 5,272,326 (GRCm39) missense possibly damaging 0.80
R2091:Ptger4 UTSW 15 5,272,326 (GRCm39) missense possibly damaging 0.80
R2091:Ptger4 UTSW 15 5,272,326 (GRCm39) missense possibly damaging 0.80
R2484:Ptger4 UTSW 15 5,264,654 (GRCm39) missense probably benign 0.06
R2873:Ptger4 UTSW 15 5,264,286 (GRCm39) missense probably benign 0.02
R4515:Ptger4 UTSW 15 5,271,860 (GRCm39) missense probably damaging 1.00
R4572:Ptger4 UTSW 15 5,272,614 (GRCm39) missense probably benign 0.00
R4655:Ptger4 UTSW 15 5,272,545 (GRCm39) missense probably benign 0.06
R4860:Ptger4 UTSW 15 5,272,087 (GRCm39) missense probably benign 0.02
R4860:Ptger4 UTSW 15 5,272,087 (GRCm39) missense probably benign 0.02
R6429:Ptger4 UTSW 15 5,272,478 (GRCm39) missense possibly damaging 0.76
R6960:Ptger4 UTSW 15 5,264,196 (GRCm39) missense probably benign
R7992:Ptger4 UTSW 15 5,264,381 (GRCm39) missense probably damaging 0.99
R8471:Ptger4 UTSW 15 5,271,800 (GRCm39) missense probably damaging 1.00
R8768:Ptger4 UTSW 15 5,272,138 (GRCm39) missense probably benign 0.00
R9245:Ptger4 UTSW 15 5,273,193 (GRCm39) start gained probably benign
R9638:Ptger4 UTSW 15 5,264,693 (GRCm39) missense probably damaging 1.00
R9790:Ptger4 UTSW 15 5,273,178 (GRCm39) start codon destroyed probably null 0.00
R9791:Ptger4 UTSW 15 5,273,178 (GRCm39) start codon destroyed probably null 0.00
Predicted Primers PCR Primer
(F):5'- AGTCGATGAAGCACCAGGTG -3'
(R):5'- GTAGTATTGTGCAAGTCGCG -3'

Sequencing Primer
(F):5'- CAGGTGCCCGGGTACTG -3'
(R):5'- AGAGACGACCTTTTACACTCTAG -3'
Posted On 2014-06-23