Incidental Mutation 'R1801:Med15'
ID 203174
Institutional Source Beutler Lab
Gene Symbol Med15
Ensembl Gene ENSMUSG00000012114
Gene Name mediator complex subunit 15
Synonyms A230074L19Rik, Pcqap
MMRRC Submission 039831-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R1801 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 17469072-17540811 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17498599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 98 (T98A)
Ref Sequence ENSEMBL: ENSMUSP00000156139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012259] [ENSMUST00000080936] [ENSMUST00000231413] [ENSMUST00000231674] [ENSMUST00000232202] [ENSMUST00000232236] [ENSMUST00000232431] [ENSMUST00000232645]
AlphaFold Q924H2
Predicted Effect unknown
Transcript: ENSMUST00000012259
AA Change: T89A
SMART Domains Protein: ENSMUSP00000012259
Gene: ENSMUSG00000012114
AA Change: T89A

DomainStartEndE-ValueType
Pfam:Med15 17 789 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000080936
AA Change: T89A
SMART Domains Protein: ENSMUSP00000079737
Gene: ENSMUSG00000012114
AA Change: T89A

DomainStartEndE-ValueType
Pfam:Med15 17 749 1.2e-276 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000231413
AA Change: T63A
Predicted Effect probably benign
Transcript: ENSMUST00000231674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232005
Predicted Effect probably benign
Transcript: ENSMUST00000232163
Predicted Effect possibly damaging
Transcript: ENSMUST00000232202
AA Change: T98A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect unknown
Transcript: ENSMUST00000232236
AA Change: T89A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232401
Predicted Effect unknown
Transcript: ENSMUST00000232431
AA Change: T63A
Predicted Effect probably benign
Transcript: ENSMUST00000232645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232667
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,903,230 (GRCm39) E362G probably damaging Het
Abcc5 T C 16: 20,157,637 (GRCm39) M1307V probably benign Het
Adam34l A T 8: 44,078,954 (GRCm39) C423* probably null Het
Adamts9 A G 6: 92,840,357 (GRCm39) V1142A probably benign Het
Ano10 T C 9: 122,082,096 (GRCm39) N525S probably damaging Het
Bpifa2 T C 2: 153,853,424 (GRCm39) probably null Het
C7 C T 15: 5,041,503 (GRCm39) V468I possibly damaging Het
Carf A T 1: 60,180,664 (GRCm39) H362L possibly damaging Het
Ccdc171 A C 4: 83,465,132 (GRCm39) I37L probably benign Het
Ccdc182 T C 11: 88,185,016 (GRCm39) L32P possibly damaging Het
Celsr3 A T 9: 108,711,825 (GRCm39) D1678V possibly damaging Het
Col7a1 A T 9: 108,790,065 (GRCm39) Y920F unknown Het
Cpsf3 T C 12: 21,363,791 (GRCm39) V627A probably benign Het
D7Ertd443e A G 7: 133,871,941 (GRCm39) M640T probably damaging Het
Ddi2 T C 4: 141,411,283 (GRCm39) D543G probably damaging Het
Dnah9 T C 11: 65,846,123 (GRCm39) N2972D probably damaging Het
Dnajc18 T C 18: 35,813,857 (GRCm39) D304G probably damaging Het
Epg5 T C 18: 78,026,705 (GRCm39) V1232A possibly damaging Het
Ezr T C 17: 7,009,771 (GRCm39) T358A possibly damaging Het
Filip1 A G 9: 79,723,128 (GRCm39) S1164P probably damaging Het
Gmip T C 8: 70,267,127 (GRCm39) V341A probably benign Het
Gnb3 A C 6: 124,812,599 (GRCm39) F286V probably benign Het
Gpatch2 T A 1: 186,958,028 (GRCm39) S128T probably benign Het
Gpr87 T C 3: 59,086,813 (GRCm39) R231G possibly damaging Het
Hip1r G A 5: 124,136,871 (GRCm39) R613Q probably benign Het
Hsd3b7 T C 7: 127,402,206 (GRCm39) Y284H possibly damaging Het
Il1rap A T 16: 26,517,625 (GRCm39) D275V probably damaging Het
Il4 G T 11: 53,509,365 (GRCm39) H23Q possibly damaging Het
Kit A G 5: 75,809,053 (GRCm39) Y749C probably damaging Het
Klb A G 5: 65,506,578 (GRCm39) K275R probably null Het
Klhl12 G T 1: 134,416,808 (GRCm39) R510L probably damaging Het
Lrrc8b A G 5: 105,628,689 (GRCm39) Y345C probably damaging Het
Mmp1a T A 9: 7,475,391 (GRCm39) Y387N probably damaging Het
Myrf C A 19: 10,191,555 (GRCm39) V928L probably benign Het
Nr1d1 T C 11: 98,662,325 (GRCm39) K134E probably damaging Het
Nrxn3 A T 12: 90,250,356 (GRCm39) D305V probably damaging Het
Obscn A C 11: 58,889,147 (GRCm39) S7542A unknown Het
Or4a27 T A 2: 88,559,608 (GRCm39) I112F probably damaging Het
Pak4 G A 7: 28,264,615 (GRCm39) R96C probably damaging Het
Pde6b A T 5: 108,575,713 (GRCm39) D691V possibly damaging Het
Pdss2 A G 10: 43,221,601 (GRCm39) E171G probably benign Het
Pdzd2 C T 15: 12,387,740 (GRCm39) V873I possibly damaging Het
Plb1 A T 5: 32,450,587 (GRCm39) D376V probably damaging Het
Plekhg1 T C 10: 3,913,904 (GRCm39) Y1209H probably damaging Het
Prickle2 A G 6: 92,393,885 (GRCm39) C263R probably damaging Het
Psma2 A T 13: 14,798,190 (GRCm39) Y104F probably benign Het
Ptger4 T A 15: 5,272,281 (GRCm39) M113L possibly damaging Het
Rgs10 T G 7: 128,006,201 (GRCm39) D17A possibly damaging Het
Rpap3 A G 15: 97,592,090 (GRCm39) S189P possibly damaging Het
Rsbn1 T C 3: 103,822,188 (GRCm39) L102P probably damaging Het
Ryr2 T C 13: 11,610,167 (GRCm39) S655G probably benign Het
Samd4b A T 7: 28,106,756 (GRCm39) probably null Het
Sema4a C T 3: 88,344,056 (GRCm39) D732N probably benign Het
Sh3bp5l A G 11: 58,237,177 (GRCm39) D378G probably benign Het
Sh3gl3 C T 7: 81,933,327 (GRCm39) T230I possibly damaging Het
Slc28a2b C T 2: 122,352,133 (GRCm39) R324C possibly damaging Het
Slc5a1 A T 5: 33,304,297 (GRCm39) Q299L probably damaging Het
Ssc5d C A 7: 4,939,606 (GRCm39) H681N probably benign Het
Sugp2 T C 8: 70,689,360 (GRCm39) S10P possibly damaging Het
Supt5 A G 7: 28,016,639 (GRCm39) probably null Het
Syna A G 5: 134,588,943 (GRCm39) V2A probably benign Het
Tcp1 T A 17: 13,141,089 (GRCm39) Y299* probably null Het
Tenm3 C A 8: 48,729,291 (GRCm39) V1572L probably benign Het
Tent4b T G 8: 88,977,416 (GRCm39) V406G probably benign Het
Trp53rka A G 2: 165,333,533 (GRCm39) S119P probably damaging Het
Ubr4 T A 4: 139,179,874 (GRCm39) probably null Het
Uchl4 T A 9: 64,142,757 (GRCm39) D79E probably benign Het
Vmn2r17 C A 5: 109,576,344 (GRCm39) T405K probably damaging Het
Xpnpep1 A G 19: 52,998,564 (GRCm39) L228P probably damaging Het
Xrcc4 T G 13: 90,140,698 (GRCm39) E170D probably damaging Het
Zfp945 T C 17: 23,070,736 (GRCm39) T388A probably damaging Het
Zfp947 G A 17: 22,365,443 (GRCm39) A77V probably benign Het
Zkscan5 G A 5: 145,157,015 (GRCm39) G433R probably damaging Het
Other mutations in Med15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Med15 APN 16 17,498,590 (GRCm39) missense probably damaging 0.96
IGL00780:Med15 APN 16 17,471,351 (GRCm39) missense probably damaging 1.00
IGL02365:Med15 APN 16 17,489,470 (GRCm39) intron probably benign
R0324:Med15 UTSW 16 17,515,476 (GRCm39) missense probably damaging 0.98
R1225:Med15 UTSW 16 17,540,652 (GRCm39) missense probably damaging 1.00
R1695:Med15 UTSW 16 17,540,644 (GRCm39) missense probably damaging 0.96
R1745:Med15 UTSW 16 17,473,570 (GRCm39) unclassified probably benign
R1838:Med15 UTSW 16 17,471,426 (GRCm39) missense probably benign 0.11
R1901:Med15 UTSW 16 17,491,018 (GRCm39) unclassified probably benign
R2153:Med15 UTSW 16 17,503,315 (GRCm39) critical splice donor site probably null
R2974:Med15 UTSW 16 17,470,575 (GRCm39) missense probably damaging 1.00
R3808:Med15 UTSW 16 17,473,598 (GRCm39) unclassified probably benign
R3809:Med15 UTSW 16 17,473,598 (GRCm39) unclassified probably benign
R4240:Med15 UTSW 16 17,473,358 (GRCm39) missense probably damaging 1.00
R4483:Med15 UTSW 16 17,489,428 (GRCm39) intron probably benign
R4484:Med15 UTSW 16 17,489,428 (GRCm39) intron probably benign
R4577:Med15 UTSW 16 17,492,379 (GRCm39) nonsense probably null
R5652:Med15 UTSW 16 17,473,055 (GRCm39) missense probably damaging 1.00
R6244:Med15 UTSW 16 17,470,609 (GRCm39) nonsense probably null
R6701:Med15 UTSW 16 17,489,447 (GRCm39) intron probably benign
R6793:Med15 UTSW 16 17,470,567 (GRCm39) unclassified probably benign
R7036:Med15 UTSW 16 17,516,019 (GRCm39) start codon destroyed probably null
R7038:Med15 UTSW 16 17,470,591 (GRCm39) missense possibly damaging 0.90
R7211:Med15 UTSW 16 17,515,977 (GRCm39) missense unknown
R7317:Med15 UTSW 16 17,489,507 (GRCm39) missense unknown
R7390:Med15 UTSW 16 17,540,626 (GRCm39) missense unknown
R7471:Med15 UTSW 16 17,540,729 (GRCm39) missense probably benign 0.03
R7726:Med15 UTSW 16 17,473,038 (GRCm39) missense possibly damaging 0.87
R8872:Med15 UTSW 16 17,470,605 (GRCm39) missense probably damaging 1.00
R9043:Med15 UTSW 16 17,470,582 (GRCm39) missense probably benign 0.07
R9084:Med15 UTSW 16 17,471,072 (GRCm39) missense probably damaging 0.99
R9089:Med15 UTSW 16 17,473,421 (GRCm39) missense unknown
R9363:Med15 UTSW 16 17,489,414 (GRCm39) missense unknown
Z1177:Med15 UTSW 16 17,471,096 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGTGGAGTTGCTGTAGACACC -3'
(R):5'- TTCCAGCAGTTCCAAGTCTTG -3'

Sequencing Primer
(F):5'- GAGTTGCTGTAGACACCACAGC -3'
(R):5'- CCAGACTTGGGGAATTTCAGGC -3'
Posted On 2014-06-23