Mutagenetix > Incidental Mutations

Incidental Mutation 'R1801:Epg5'

203182

Institutional Source

Beutler Lab

Gene Symbol

Epg5

Ensembl Gene

ENSMUSG00000039840

Gene Name

ectopic P-granules autophagy protein 5 homolog (C. elegans)

Synonyms

MMRRC Submission

039831-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R1801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77938467-78035027 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77983490 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1232 (V1232A)

Ref Sequence

ENSEMBL: ENSMUSP00000038681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044622]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044622
AA Change: V1232A

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: V1232A

Domain	Start	End	E-Value	Type
low complexity region	299	309	N/A	INTRINSIC
low complexity region	395	406	N/A	INTRINSIC
low complexity region	1074	1085	N/A	INTRINSIC
low complexity region	1499	1516	N/A	INTRINSIC
coiled coil region	1600	1626	N/A	INTRINSIC
low complexity region	2132	2145	N/A	INTRINSIC
low complexity region	2416	2427	N/A	INTRINSIC
low complexity region	2454	2469	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,067,396	E362G	probably damaging	Het
Abcc5	T	C	16: 20,338,887	M1307V	probably benign	Het
Adamts9	A	G	6: 92,863,376	V1142A	probably benign	Het
Ano10	T	C	9: 122,253,030	N525S	probably damaging	Het
Bpifa2	T	C	2: 154,011,504		probably null	Het
C7	C	T	15: 5,012,021	V468I	possibly damaging	Het
Carf	A	T	1: 60,141,505	H362L	possibly damaging	Het
Ccdc171	A	C	4: 83,546,895	I37L	probably benign	Het
Ccdc182	T	C	11: 88,294,190	L32P	possibly damaging	Het
Celsr3	A	T	9: 108,834,626	D1678V	possibly damaging	Het
Col7a1	A	T	9: 108,960,997	Y920F	unknown	Het
Cpsf3	T	C	12: 21,313,790	V627A	probably benign	Het
D7Ertd443e	A	G	7: 134,270,212	M640T	probably damaging	Het
Ddi2	T	C	4: 141,683,972	D543G	probably damaging	Het
Dnah9	T	C	11: 65,955,297	N2972D	probably damaging	Het
Dnajc18	T	C	18: 35,680,804	D304G	probably damaging	Het
Ezr	T	C	17: 6,742,372	T358A	possibly damaging	Het
Filip1	A	G	9: 79,815,846	S1164P	probably damaging	Het
Gm14085	C	T	2: 122,521,652	R324C	possibly damaging	Het
Gm5346	A	T	8: 43,625,917	C423*	probably null	Het
Gmip	T	C	8: 69,814,477	V341A	probably benign	Het
Gnb3	A	C	6: 124,835,636	F286V	probably benign	Het
Gpatch2	T	A	1: 187,225,831	S128T	probably benign	Het
Gpr87	T	C	3: 59,179,392	R231G	possibly damaging	Het
Hip1r	G	A	5: 123,998,808	R613Q	probably benign	Het
Hsd3b7	T	C	7: 127,803,034	Y284H	possibly damaging	Het
Il1rap	A	T	16: 26,698,875	D275V	probably damaging	Het
Il4	G	T	11: 53,618,538	H23Q	possibly damaging	Het
Kit	A	G	5: 75,648,393	Y749C	probably damaging	Het
Klb	A	G	5: 65,349,235	K275R	probably null	Het
Klhl12	G	T	1: 134,489,070	R510L	probably damaging	Het
Lrrc8b	A	G	5: 105,480,823	Y345C	probably damaging	Het
Med15	T	C	16: 17,680,735	T98A	possibly damaging	Het
Mmp1a	T	A	9: 7,475,390	Y387N	probably damaging	Het
Myrf	C	A	19: 10,214,191	V928L	probably benign	Het
Nr1d1	T	C	11: 98,771,499	K134E	probably damaging	Het
Nrxn3	A	T	12: 90,283,582	D305V	probably damaging	Het
Obscn	A	C	11: 58,998,321	S7542A	unknown	Het
Olfr1197	T	A	2: 88,729,264	I112F	probably damaging	Het
Pak4	G	A	7: 28,565,190	R96C	probably damaging	Het
Papd5	T	G	8: 88,250,788	V406G	probably benign	Het
Pde6b	A	T	5: 108,427,847	D691V	possibly damaging	Het
Pdss2	A	G	10: 43,345,605	E171G	probably benign	Het
Pdzd2	C	T	15: 12,387,654	V873I	possibly damaging	Het
Plb1	A	T	5: 32,293,243	D376V	probably damaging	Het
Plekhg1	T	C	10: 3,963,904	Y1209H	probably damaging	Het
Prickle2	A	G	6: 92,416,904	C263R	probably damaging	Het
Psma2	A	T	13: 14,623,605	Y104F	probably benign	Het
Ptger4	T	A	15: 5,242,800	M113L	possibly damaging	Het
Rgs10	T	G	7: 128,404,477	D17A	possibly damaging	Het
Rpap3	A	G	15: 97,694,209	S189P	possibly damaging	Het
Rsbn1	T	C	3: 103,914,872	L102P	probably damaging	Het
Ryr2	T	C	13: 11,595,281	S655G	probably benign	Het
Samd4b	A	T	7: 28,407,331		probably null	Het
Sema4a	C	T	3: 88,436,749	D732N	probably benign	Het
Sh3bp5l	A	G	11: 58,346,351	D378G	probably benign	Het
Sh3gl3	C	T	7: 82,284,119	T230I	possibly damaging	Het
Slc5a1	A	T	5: 33,146,953	Q299L	probably damaging	Het
Ssc5d	C	A	7: 4,936,607	H681N	probably benign	Het
Sugp2	T	C	8: 70,236,710	S10P	possibly damaging	Het
Supt5	A	G	7: 28,317,214		probably null	Het
Syna	A	G	5: 134,560,089	V2A	probably benign	Het
Tcp1	T	A	17: 12,922,202	Y299*	probably null	Het
Tenm3	C	A	8: 48,276,256	V1572L	probably benign	Het
Trp53rka	A	G	2: 165,491,613	S119P	probably damaging	Het
Ubr4	T	A	4: 139,452,563		probably null	Het
Uchl4	T	A	9: 64,235,475	D79E	probably benign	Het
Vmn2r17	C	A	5: 109,428,478	T405K	probably damaging	Het
Xpnpep1	A	G	19: 53,010,133	L228P	probably damaging	Het
Xrcc4	T	G	13: 89,992,579	E170D	probably damaging	Het
Zfp945	T	C	17: 22,851,762	T388A	probably damaging	Het
Zfp947	G	A	17: 22,146,462	A77V	probably benign	Het
Zkscan5	G	A	5: 145,220,205	G433R	probably damaging	Het

Other mutations in Epg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Epg5	APN	18	78012741	missense	probably damaging	1.00
IGL01778:Epg5	APN	18	78019274	missense	probably damaging	0.98
IGL01936:Epg5	APN	18	77985101	missense	probably damaging	1.00
IGL02189:Epg5	APN	18	78012870	missense	probably damaging	0.99
IGL02323:Epg5	APN	18	78012832	nonsense	probably null
IGL02567:Epg5	APN	18	78033073	missense	probably damaging	1.00
IGL02805:Epg5	APN	18	78030191	splice site	probably benign
IGL03282:Epg5	APN	18	77986426	missense	probably benign	0.25
stitch	UTSW	18	77948299	nonsense	probably null
R0011:Epg5	UTSW	18	77948483	missense	probably benign
R0172:Epg5	UTSW	18	78027359	missense	probably benign	0.00
R0335:Epg5	UTSW	18	77986472	missense	probably benign	0.25
R0380:Epg5	UTSW	18	77960841	missense	probably damaging	1.00
R0441:Epg5	UTSW	18	78023271	splice site	probably benign
R0443:Epg5	UTSW	18	77955903	splice site	probably benign
R0445:Epg5	UTSW	18	78014184	missense	possibly damaging	0.87
R0448:Epg5	UTSW	18	78023365	missense	probably damaging	1.00
R0892:Epg5	UTSW	18	77968628	missense	possibly damaging	0.94
R1081:Epg5	UTSW	18	77959533	missense	possibly damaging	0.92
R1183:Epg5	UTSW	18	77960711	missense	probably damaging	1.00
R1374:Epg5	UTSW	18	77981326	missense	probably benign
R1428:Epg5	UTSW	18	77962427	missense	probably damaging	1.00
R1727:Epg5	UTSW	18	78015815	missense	possibly damaging	0.94
R1780:Epg5	UTSW	18	78023990	missense	probably damaging	0.99
R1864:Epg5	UTSW	18	77975031	missense	probably damaging	0.99
R1908:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1909:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1916:Epg5	UTSW	18	77965021	missense	probably benign	0.00
R1986:Epg5	UTSW	18	77982306	critical splice acceptor site	probably null
R2048:Epg5	UTSW	18	78023987	missense	probably damaging	0.98
R2080:Epg5	UTSW	18	77948745	missense	probably benign	0.01
R2106:Epg5	UTSW	18	77991363	nonsense	probably null
R2144:Epg5	UTSW	18	77954197	missense	possibly damaging	0.78
R2151:Epg5	UTSW	18	78027302	missense	probably benign
R2217:Epg5	UTSW	18	77949072	missense	probably benign
R2424:Epg5	UTSW	18	77968613	missense	probably benign	0.05
R2909:Epg5	UTSW	18	77983476	missense	probably damaging	1.00
R3725:Epg5	UTSW	18	78017679	missense	probably benign	0.00
R3899:Epg5	UTSW	18	77957510	missense	probably damaging	1.00
R4019:Epg5	UTSW	18	78030450	missense	probably damaging	0.98
R4260:Epg5	UTSW	18	77959121	missense	possibly damaging	0.50
R4260:Epg5	UTSW	18	78015699	missense	probably damaging	1.00
R4448:Epg5	UTSW	18	77962461	missense	probably damaging	1.00
R4475:Epg5	UTSW	18	77948508	missense	probably benign
R4612:Epg5	UTSW	18	77982414	missense	possibly damaging	0.77
R4666:Epg5	UTSW	18	78012864	missense	probably benign	0.45
R4767:Epg5	UTSW	18	78023283	missense	possibly damaging	0.67
R4779:Epg5	UTSW	18	77991365	missense	probably benign	0.01
R4791:Epg5	UTSW	18	77948996	nonsense	probably null
R4797:Epg5	UTSW	18	78030399	missense	probably benign	0.00
R4812:Epg5	UTSW	18	77979184	missense	probably benign	0.01
R4899:Epg5	UTSW	18	77985057	missense	probably damaging	1.00
R5000:Epg5	UTSW	18	77954161	missense	probably benign
R5031:Epg5	UTSW	18	78028948	missense	probably benign	0.00
R5050:Epg5	UTSW	18	77975941	missense	possibly damaging	0.55
R5114:Epg5	UTSW	18	77995613	missense	probably benign
R5144:Epg5	UTSW	18	78015680	missense	probably damaging	1.00
R5209:Epg5	UTSW	18	77951282	missense	probably damaging	1.00
R5213:Epg5	UTSW	18	78014834	missense	probably benign	0.01
R5270:Epg5	UTSW	18	77983563	missense	possibly damaging	0.79
R5324:Epg5	UTSW	18	77962445	missense	possibly damaging	0.94
R5443:Epg5	UTSW	18	78027497	missense	possibly damaging	0.55
R5503:Epg5	UTSW	18	77951207	missense	possibly damaging	0.81
R5593:Epg5	UTSW	18	77957474	missense	probably damaging	1.00
R5718:Epg5	UTSW	18	77986403	missense	probably damaging	1.00
R5773:Epg5	UTSW	18	77960825	missense	probably damaging	1.00
R5828:Epg5	UTSW	18	78020851	missense	probably damaging	0.99
R5847:Epg5	UTSW	18	78030055	missense	probably benign	0.06
R5858:Epg5	UTSW	18	77948299	nonsense	probably null
R5914:Epg5	UTSW	18	77959632	critical splice donor site	probably null
R6124:Epg5	UTSW	18	78030045	missense	probably benign
R6228:Epg5	UTSW	18	77948462	missense	possibly damaging	0.90
R6252:Epg5	UTSW	18	77985167	missense	probably damaging	1.00
R6269:Epg5	UTSW	18	77948370	missense	probably benign
R6312:Epg5	UTSW	18	77979211	missense	possibly damaging	0.72
R6320:Epg5	UTSW	18	77962398	missense	probably damaging	1.00
R6328:Epg5	UTSW	18	78028964	missense	possibly damaging	0.88
R6430:Epg5	UTSW	18	77975885	missense	probably damaging	1.00
R6458:Epg5	UTSW	18	77948254	missense	probably benign	0.03
R6852:Epg5	UTSW	18	78012891	missense	probably damaging	1.00
R6915:Epg5	UTSW	18	77979165	missense	probably benign	0.00
R6930:Epg5	UTSW	18	78014163	missense	probably damaging	0.99
R6932:Epg5	UTSW	18	77948609	missense	probably benign	0.00
R7127:Epg5	UTSW	18	78028925	missense	probably damaging	1.00
R7207:Epg5	UTSW	18	77948955	missense	probably damaging	1.00
R7225:Epg5	UTSW	18	78012702	missense	probably benign	0.45
R7358:Epg5	UTSW	18	77959037	missense	possibly damaging	0.78
R7414:Epg5	UTSW	18	77983532	missense	possibly damaging	0.65
R7437:Epg5	UTSW	18	78023278	missense	probably benign	0.01
R7535:Epg5	UTSW	18	78032926	missense	probably benign	0.18
R7586:Epg5	UTSW	18	78030060	missense	probably benign
R7651:Epg5	UTSW	18	77981400	nonsense	probably null
R7715:Epg5	UTSW	18	77968586	missense	probably damaging	1.00
R7753:Epg5	UTSW	18	77948345	missense	possibly damaging	0.92
R7981:Epg5	UTSW	18	78009714	critical splice donor site	probably null
R8114:Epg5	UTSW	18	78030150	missense	probably benign	0.41
R8124:Epg5	UTSW	18	77964996	missense	probably benign	0.05
R8307:Epg5	UTSW	18	78022679	missense	probably damaging	1.00
R8458:Epg5	UTSW	18	77948731	missense	probably benign	0.00
R8751:Epg5	UTSW	18	77965008	missense	probably benign	0.07
R8751:Epg5	UTSW	18	77965009	missense	possibly damaging	0.65
R8751:Epg5	UTSW	18	77965010	missense	probably benign	0.28
R8888:Epg5	UTSW	18	78012871	missense	possibly damaging	0.76
X0023:Epg5	UTSW	18	77968657	missense	probably damaging	0.99
X0060:Epg5	UTSW	18	77962485	missense	possibly damaging	0.94
Z1088:Epg5	UTSW	18	77959139	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACTCAATATCTGTGGCTTGAGAC -3'
(R):5'- TTAACAGGCTACAGTGAACGGC -3'

Sequencing Primer
(F):5'- GCTTGAGACCTGCATGCATG -3'
(R):5'- CTACAGTGAACGGCTCAGCTAG -3'

Posted On

2014-06-23