Incidental Mutation 'R1801:Epg5'
ID203182
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Nameectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
MMRRC Submission 039831-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R1801 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location77938467-78035027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77983490 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1232 (V1232A)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044622
AA Change: V1232A

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: V1232A

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,396 E362G probably damaging Het
Abcc5 T C 16: 20,338,887 M1307V probably benign Het
Adamts9 A G 6: 92,863,376 V1142A probably benign Het
Ano10 T C 9: 122,253,030 N525S probably damaging Het
Bpifa2 T C 2: 154,011,504 probably null Het
C7 C T 15: 5,012,021 V468I possibly damaging Het
Carf A T 1: 60,141,505 H362L possibly damaging Het
Ccdc171 A C 4: 83,546,895 I37L probably benign Het
Ccdc182 T C 11: 88,294,190 L32P possibly damaging Het
Celsr3 A T 9: 108,834,626 D1678V possibly damaging Het
Col7a1 A T 9: 108,960,997 Y920F unknown Het
Cpsf3 T C 12: 21,313,790 V627A probably benign Het
D7Ertd443e A G 7: 134,270,212 M640T probably damaging Het
Ddi2 T C 4: 141,683,972 D543G probably damaging Het
Dnah9 T C 11: 65,955,297 N2972D probably damaging Het
Dnajc18 T C 18: 35,680,804 D304G probably damaging Het
Ezr T C 17: 6,742,372 T358A possibly damaging Het
Filip1 A G 9: 79,815,846 S1164P probably damaging Het
Gm14085 C T 2: 122,521,652 R324C possibly damaging Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gmip T C 8: 69,814,477 V341A probably benign Het
Gnb3 A C 6: 124,835,636 F286V probably benign Het
Gpatch2 T A 1: 187,225,831 S128T probably benign Het
Gpr87 T C 3: 59,179,392 R231G possibly damaging Het
Hip1r G A 5: 123,998,808 R613Q probably benign Het
Hsd3b7 T C 7: 127,803,034 Y284H possibly damaging Het
Il1rap A T 16: 26,698,875 D275V probably damaging Het
Il4 G T 11: 53,618,538 H23Q possibly damaging Het
Kit A G 5: 75,648,393 Y749C probably damaging Het
Klb A G 5: 65,349,235 K275R probably null Het
Klhl12 G T 1: 134,489,070 R510L probably damaging Het
Lrrc8b A G 5: 105,480,823 Y345C probably damaging Het
Med15 T C 16: 17,680,735 T98A possibly damaging Het
Mmp1a T A 9: 7,475,390 Y387N probably damaging Het
Myrf C A 19: 10,214,191 V928L probably benign Het
Nr1d1 T C 11: 98,771,499 K134E probably damaging Het
Nrxn3 A T 12: 90,283,582 D305V probably damaging Het
Obscn A C 11: 58,998,321 S7542A unknown Het
Olfr1197 T A 2: 88,729,264 I112F probably damaging Het
Pak4 G A 7: 28,565,190 R96C probably damaging Het
Papd5 T G 8: 88,250,788 V406G probably benign Het
Pde6b A T 5: 108,427,847 D691V possibly damaging Het
Pdss2 A G 10: 43,345,605 E171G probably benign Het
Pdzd2 C T 15: 12,387,654 V873I possibly damaging Het
Plb1 A T 5: 32,293,243 D376V probably damaging Het
Plekhg1 T C 10: 3,963,904 Y1209H probably damaging Het
Prickle2 A G 6: 92,416,904 C263R probably damaging Het
Psma2 A T 13: 14,623,605 Y104F probably benign Het
Ptger4 T A 15: 5,242,800 M113L possibly damaging Het
Rgs10 T G 7: 128,404,477 D17A possibly damaging Het
Rpap3 A G 15: 97,694,209 S189P possibly damaging Het
Rsbn1 T C 3: 103,914,872 L102P probably damaging Het
Ryr2 T C 13: 11,595,281 S655G probably benign Het
Samd4b A T 7: 28,407,331 probably null Het
Sema4a C T 3: 88,436,749 D732N probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Sh3gl3 C T 7: 82,284,119 T230I possibly damaging Het
Slc5a1 A T 5: 33,146,953 Q299L probably damaging Het
Ssc5d C A 7: 4,936,607 H681N probably benign Het
Sugp2 T C 8: 70,236,710 S10P possibly damaging Het
Supt5 A G 7: 28,317,214 probably null Het
Syna A G 5: 134,560,089 V2A probably benign Het
Tcp1 T A 17: 12,922,202 Y299* probably null Het
Tenm3 C A 8: 48,276,256 V1572L probably benign Het
Trp53rka A G 2: 165,491,613 S119P probably damaging Het
Ubr4 T A 4: 139,452,563 probably null Het
Uchl4 T A 9: 64,235,475 D79E probably benign Het
Vmn2r17 C A 5: 109,428,478 T405K probably damaging Het
Xpnpep1 A G 19: 53,010,133 L228P probably damaging Het
Xrcc4 T G 13: 89,992,579 E170D probably damaging Het
Zfp945 T C 17: 22,851,762 T388A probably damaging Het
Zfp947 G A 17: 22,146,462 A77V probably benign Het
Zkscan5 G A 5: 145,220,205 G433R probably damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
R7358:Epg5 UTSW 18 77959037 missense possibly damaging 0.78
R7414:Epg5 UTSW 18 77983532 missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78023278 missense probably benign 0.01
R7535:Epg5 UTSW 18 78032926 missense probably benign 0.18
R7586:Epg5 UTSW 18 78030060 missense probably benign
R7651:Epg5 UTSW 18 77981400 nonsense probably null
R7715:Epg5 UTSW 18 77968586 missense probably damaging 1.00
R7753:Epg5 UTSW 18 77948345 missense possibly damaging 0.92
R7981:Epg5 UTSW 18 78009714 critical splice donor site probably null
R8114:Epg5 UTSW 18 78030150 missense probably benign 0.41
R8124:Epg5 UTSW 18 77964996 missense probably benign 0.05
R8307:Epg5 UTSW 18 78022679 missense probably damaging 1.00
R8458:Epg5 UTSW 18 77948731 missense probably benign 0.00
R8751:Epg5 UTSW 18 77965008 missense probably benign 0.07
R8751:Epg5 UTSW 18 77965009 missense possibly damaging 0.65
R8751:Epg5 UTSW 18 77965010 missense probably benign 0.28
R8888:Epg5 UTSW 18 78012871 missense possibly damaging 0.76
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTCAATATCTGTGGCTTGAGAC -3'
(R):5'- TTAACAGGCTACAGTGAACGGC -3'

Sequencing Primer
(F):5'- GCTTGAGACCTGCATGCATG -3'
(R):5'- CTACAGTGAACGGCTCAGCTAG -3'
Posted On2014-06-23