Incidental Mutation 'R1801:Xpnpep1'
ID 203185
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene Name X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms D230045I08Rik
MMRRC Submission 039831-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1801 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 52919710-53027093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52998564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 228 (L228P)
Ref Sequence ENSEMBL: ENSMUSP00000138233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182097] [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
AlphaFold Q6P1B1
Predicted Effect possibly damaging
Transcript: ENSMUST00000069988
AA Change: L185P

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070946
Gene: ENSMUSG00000025027
AA Change: L185P

DomainStartEndE-ValueType
Pfam:Creatinase_N 10 154 5.2e-15 PFAM
Pfam:Creatinase_N_2 157 326 1.4e-47 PFAM
Pfam:Peptidase_M24 328 544 7.2e-52 PFAM
Pfam:Peptidase_M24_C 555 619 7.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182097
SMART Domains Protein: ENSMUSP00000138473
Gene: ENSMUSG00000025027

DomainStartEndE-ValueType
Pfam:Creatinase_N 9 119 5.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182877
Predicted Effect possibly damaging
Transcript: ENSMUST00000183108
AA Change: L228P

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: L228P

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183188
Predicted Effect probably damaging
Transcript: ENSMUST00000183274
AA Change: L228P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: L228P

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184510
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,903,230 (GRCm39) E362G probably damaging Het
Abcc5 T C 16: 20,157,637 (GRCm39) M1307V probably benign Het
Adam34l A T 8: 44,078,954 (GRCm39) C423* probably null Het
Adamts9 A G 6: 92,840,357 (GRCm39) V1142A probably benign Het
Ano10 T C 9: 122,082,096 (GRCm39) N525S probably damaging Het
Bpifa2 T C 2: 153,853,424 (GRCm39) probably null Het
C7 C T 15: 5,041,503 (GRCm39) V468I possibly damaging Het
Carf A T 1: 60,180,664 (GRCm39) H362L possibly damaging Het
Ccdc171 A C 4: 83,465,132 (GRCm39) I37L probably benign Het
Ccdc182 T C 11: 88,185,016 (GRCm39) L32P possibly damaging Het
Celsr3 A T 9: 108,711,825 (GRCm39) D1678V possibly damaging Het
Col7a1 A T 9: 108,790,065 (GRCm39) Y920F unknown Het
Cpsf3 T C 12: 21,363,791 (GRCm39) V627A probably benign Het
D7Ertd443e A G 7: 133,871,941 (GRCm39) M640T probably damaging Het
Ddi2 T C 4: 141,411,283 (GRCm39) D543G probably damaging Het
Dnah9 T C 11: 65,846,123 (GRCm39) N2972D probably damaging Het
Dnajc18 T C 18: 35,813,857 (GRCm39) D304G probably damaging Het
Epg5 T C 18: 78,026,705 (GRCm39) V1232A possibly damaging Het
Ezr T C 17: 7,009,771 (GRCm39) T358A possibly damaging Het
Filip1 A G 9: 79,723,128 (GRCm39) S1164P probably damaging Het
Gmip T C 8: 70,267,127 (GRCm39) V341A probably benign Het
Gnb3 A C 6: 124,812,599 (GRCm39) F286V probably benign Het
Gpatch2 T A 1: 186,958,028 (GRCm39) S128T probably benign Het
Gpr87 T C 3: 59,086,813 (GRCm39) R231G possibly damaging Het
Hip1r G A 5: 124,136,871 (GRCm39) R613Q probably benign Het
Hsd3b7 T C 7: 127,402,206 (GRCm39) Y284H possibly damaging Het
Il1rap A T 16: 26,517,625 (GRCm39) D275V probably damaging Het
Il4 G T 11: 53,509,365 (GRCm39) H23Q possibly damaging Het
Kit A G 5: 75,809,053 (GRCm39) Y749C probably damaging Het
Klb A G 5: 65,506,578 (GRCm39) K275R probably null Het
Klhl12 G T 1: 134,416,808 (GRCm39) R510L probably damaging Het
Lrrc8b A G 5: 105,628,689 (GRCm39) Y345C probably damaging Het
Med15 T C 16: 17,498,599 (GRCm39) T98A possibly damaging Het
Mmp1a T A 9: 7,475,391 (GRCm39) Y387N probably damaging Het
Myrf C A 19: 10,191,555 (GRCm39) V928L probably benign Het
Nr1d1 T C 11: 98,662,325 (GRCm39) K134E probably damaging Het
Nrxn3 A T 12: 90,250,356 (GRCm39) D305V probably damaging Het
Obscn A C 11: 58,889,147 (GRCm39) S7542A unknown Het
Or4a27 T A 2: 88,559,608 (GRCm39) I112F probably damaging Het
Pak4 G A 7: 28,264,615 (GRCm39) R96C probably damaging Het
Pde6b A T 5: 108,575,713 (GRCm39) D691V possibly damaging Het
Pdss2 A G 10: 43,221,601 (GRCm39) E171G probably benign Het
Pdzd2 C T 15: 12,387,740 (GRCm39) V873I possibly damaging Het
Plb1 A T 5: 32,450,587 (GRCm39) D376V probably damaging Het
Plekhg1 T C 10: 3,913,904 (GRCm39) Y1209H probably damaging Het
Prickle2 A G 6: 92,393,885 (GRCm39) C263R probably damaging Het
Psma2 A T 13: 14,798,190 (GRCm39) Y104F probably benign Het
Ptger4 T A 15: 5,272,281 (GRCm39) M113L possibly damaging Het
Rgs10 T G 7: 128,006,201 (GRCm39) D17A possibly damaging Het
Rpap3 A G 15: 97,592,090 (GRCm39) S189P possibly damaging Het
Rsbn1 T C 3: 103,822,188 (GRCm39) L102P probably damaging Het
Ryr2 T C 13: 11,610,167 (GRCm39) S655G probably benign Het
Samd4b A T 7: 28,106,756 (GRCm39) probably null Het
Sema4a C T 3: 88,344,056 (GRCm39) D732N probably benign Het
Sh3bp5l A G 11: 58,237,177 (GRCm39) D378G probably benign Het
Sh3gl3 C T 7: 81,933,327 (GRCm39) T230I possibly damaging Het
Slc28a2b C T 2: 122,352,133 (GRCm39) R324C possibly damaging Het
Slc5a1 A T 5: 33,304,297 (GRCm39) Q299L probably damaging Het
Ssc5d C A 7: 4,939,606 (GRCm39) H681N probably benign Het
Sugp2 T C 8: 70,689,360 (GRCm39) S10P possibly damaging Het
Supt5 A G 7: 28,016,639 (GRCm39) probably null Het
Syna A G 5: 134,588,943 (GRCm39) V2A probably benign Het
Tcp1 T A 17: 13,141,089 (GRCm39) Y299* probably null Het
Tenm3 C A 8: 48,729,291 (GRCm39) V1572L probably benign Het
Tent4b T G 8: 88,977,416 (GRCm39) V406G probably benign Het
Trp53rka A G 2: 165,333,533 (GRCm39) S119P probably damaging Het
Ubr4 T A 4: 139,179,874 (GRCm39) probably null Het
Uchl4 T A 9: 64,142,757 (GRCm39) D79E probably benign Het
Vmn2r17 C A 5: 109,576,344 (GRCm39) T405K probably damaging Het
Xrcc4 T G 13: 90,140,698 (GRCm39) E170D probably damaging Het
Zfp945 T C 17: 23,070,736 (GRCm39) T388A probably damaging Het
Zfp947 G A 17: 22,365,443 (GRCm39) A77V probably benign Het
Zkscan5 G A 5: 145,157,015 (GRCm39) G433R probably damaging Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 52,998,579 (GRCm39) missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52,985,463 (GRCm39) missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 52,988,824 (GRCm39) missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 52,990,896 (GRCm39) critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53,013,811 (GRCm39) missense probably benign
IGL03334:Xpnpep1 APN 19 52,998,577 (GRCm39) missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 52,998,583 (GRCm39) missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 52,994,784 (GRCm39) missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52,986,294 (GRCm39) splice site probably benign
R1543:Xpnpep1 UTSW 19 52,980,107 (GRCm39) missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 52,994,769 (GRCm39) missense probably benign 0.00
R1853:Xpnpep1 UTSW 19 52,994,641 (GRCm39) missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 52,994,773 (GRCm39) missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3822:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3925:Xpnpep1 UTSW 19 52,980,128 (GRCm39) missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53,003,053 (GRCm39) missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 52,994,606 (GRCm39) missense probably benign
R5184:Xpnpep1 UTSW 19 53,001,845 (GRCm39) missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52,983,950 (GRCm39) missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 52,993,253 (GRCm39) missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52,985,439 (GRCm39) missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53,001,920 (GRCm39) missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52,986,310 (GRCm39) missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53,000,275 (GRCm39) missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53,000,196 (GRCm39) critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 52,998,538 (GRCm39) missense probably benign
R7412:Xpnpep1 UTSW 19 52,994,722 (GRCm39) missense probably benign
R8329:Xpnpep1 UTSW 19 52,990,903 (GRCm39) critical splice donor site probably null
R8431:Xpnpep1 UTSW 19 52,983,937 (GRCm39) missense probably benign 0.04
R9194:Xpnpep1 UTSW 19 53,000,289 (GRCm39) missense possibly damaging 0.68
R9342:Xpnpep1 UTSW 19 52,993,248 (GRCm39) missense probably benign 0.02
R9388:Xpnpep1 UTSW 19 52,993,233 (GRCm39) missense probably damaging 1.00
R9546:Xpnpep1 UTSW 19 52,990,959 (GRCm39) missense probably damaging 1.00
R9746:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
RF017:Xpnpep1 UTSW 19 53,020,491 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ACTGCTGCAAACTGCCTCAC -3'
(R):5'- AAACATGTTCCTGGTGAGGCAG -3'

Sequencing Primer
(F):5'- TGCCTCACCATTCAGAGAGCTG -3'
(R):5'- CTCATGGCAGTCAGGTGAC -3'
Posted On 2014-06-23