Incidental Mutation 'R1802:Glrb'
ID203195
Institutional Source Beutler Lab
Gene Symbol Glrb
Ensembl Gene ENSMUSG00000028020
Gene Nameglycine receptor, beta subunit
Synonyms
MMRRC Submission 039832-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1802 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location80843599-80913660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80861957 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 154 (H154Q)
Ref Sequence ENSEMBL: ENSMUSP00000142306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029654] [ENSMUST00000107743] [ENSMUST00000132330] [ENSMUST00000135043] [ENSMUST00000194085]
Predicted Effect probably damaging
Transcript: ENSMUST00000029654
AA Change: H154Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029654
Gene: ENSMUSG00000028020
AA Change: H154Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 266 6.9e-55 PFAM
Pfam:Neur_chan_memb 273 492 4.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107743
AA Change: H154Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103372
Gene: ENSMUSG00000028020
AA Change: H154Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 266 5.7e-58 PFAM
Pfam:Neur_chan_memb 273 302 9.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132330
SMART Domains Protein: ENSMUSP00000115014
Gene: ENSMUSG00000028020

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135043
SMART Domains Protein: ENSMUSP00000116604
Gene: ENSMUSG00000028020

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193031
Predicted Effect probably damaging
Transcript: ENSMUST00000194085
AA Change: H154Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142306
Gene: ENSMUSG00000028020
AA Change: H154Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 264 6.9e-55 PFAM
Pfam:Neur_chan_memb 248 441 1.1e-22 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the glycine receptor, which is a pentamer composed of alpha and beta subunits. The receptor functions as a neurotransmitter-gated ion channel, which produces hyperpolarization via increased chloride conductance due to the binding of glycine to the receptor. This gene is transcribed throughout the central nervous system of neonatal and adult mice. In humans, mutations in this gene cause startle disease, also known as hereditary hyperekplexia or congenital stiff-person syndrome, a disease characterized by muscular rigidity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mutations in this gene result in a neurological disorder and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik T A 11: 101,988,476 Y25N possibly damaging Het
Abcd2 G T 15: 91,163,102 R583S probably benign Het
Ago2 A T 15: 73,121,180 F492Y probably damaging Het
Ano4 T A 10: 88,981,016 D610V probably damaging Het
Atp6v0d2 A G 4: 19,922,366 probably null Het
Atxn7 T G 14: 14,089,419 S312A probably benign Het
Azgp1 A G 5: 137,985,231 Y56C probably damaging Het
Bcan A G 3: 87,993,108 V606A possibly damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
Ccdc63 T C 5: 122,129,877 R9G probably damaging Het
Cdyl T A 13: 35,872,636 L534* probably null Het
Celf2 T C 2: 6,549,933 E445G probably damaging Het
Cnot8 T C 11: 58,117,535 C276R probably benign Het
Dock4 A G 12: 40,794,598 I1135V possibly damaging Het
Edc3 A G 9: 57,727,315 D205G probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Fancl T G 11: 26,459,709 S188R probably benign Het
Fbn2 T A 18: 58,052,976 K1767* probably null Het
Gm19965 C T 1: 116,820,903 R105* probably null Het
Grhpr C A 4: 44,988,950 Y202* probably null Het
Herc2 A G 7: 56,184,332 E3095G probably damaging Het
Il22ra2 A T 10: 19,626,699 N89Y probably damaging Het
Itgb6 T C 2: 60,653,281 D261G probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kif1a T A 1: 93,066,149 I360F probably damaging Het
Kmt2d T C 15: 98,862,985 Q828R unknown Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mios T A 6: 8,216,385 Y436* probably null Het
Mprip C T 11: 59,755,041 L684F probably damaging Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Naga C T 15: 82,337,468 R24Q probably benign Het
Nr2c1 G A 10: 94,163,786 V103M possibly damaging Het
Oca2 A G 7: 56,254,980 S65G possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr598 A G 7: 103,328,647 I54V probably benign Het
Phyhipl A T 10: 70,599,025 I28N probably benign Het
Pifo T A 3: 106,014,550 Q19L possibly damaging Het
Pik3cb C A 9: 99,101,289 E89* probably null Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Ppm1a T A 12: 72,793,707 probably null Het
Relt T C 7: 100,850,194 I173V probably damaging Het
Rfx7 T A 9: 72,619,637 S1370T possibly damaging Het
Rps7 G A 12: 28,634,259 R81C probably benign Het
Saa3 T C 7: 46,712,126 *123W probably null Het
Serpina3b C A 12: 104,138,637 H357Q probably damaging Het
Slc9c1 T A 16: 45,558,281 N493K probably benign Het
Spata31 T C 13: 64,922,383 Y782H probably benign Het
Tfap2a T C 13: 40,725,170 D166G probably damaging Het
Thada A T 17: 84,464,407 M9K probably benign Het
Tmem269 A T 4: 119,210,873 probably null Het
Tnxb C A 17: 34,703,889 P2482Q probably damaging Het
Vit T C 17: 78,605,511 V291A possibly damaging Het
Zfp930 G T 8: 69,226,394 A18S possibly damaging Het
Zufsp A T 10: 33,943,718 V200D probably damaging Het
Other mutations in Glrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Glrb APN 3 80861955 missense probably damaging 1.00
IGL00850:Glrb APN 3 80861781 missense probably damaging 1.00
IGL01970:Glrb APN 3 80861925 missense possibly damaging 0.92
IGL02023:Glrb APN 3 80850955 missense probably benign 0.22
IGL02494:Glrb APN 3 80845232 missense probably benign 0.01
IGL02703:Glrb APN 3 80850993 missense probably benign 0.19
I1329:Glrb UTSW 3 80862074 missense probably damaging 1.00
R0003:Glrb UTSW 3 80855914 missense probably damaging 1.00
R0010:Glrb UTSW 3 80860315 splice site probably benign
R0010:Glrb UTSW 3 80860315 splice site probably benign
R0743:Glrb UTSW 3 80879680 missense probably damaging 1.00
R1367:Glrb UTSW 3 80862004 missense probably damaging 1.00
R1491:Glrb UTSW 3 80911975 missense possibly damaging 0.81
R1699:Glrb UTSW 3 80861774 missense probably damaging 1.00
R1791:Glrb UTSW 3 80860175 missense probably damaging 1.00
R2420:Glrb UTSW 3 80860235 missense probably damaging 0.97
R2422:Glrb UTSW 3 80860235 missense probably damaging 0.97
R2517:Glrb UTSW 3 80861747 missense probably damaging 1.00
R3612:Glrb UTSW 3 80862030 missense possibly damaging 0.89
R4287:Glrb UTSW 3 80845232 missense possibly damaging 0.84
R4382:Glrb UTSW 3 80879639 missense probably damaging 1.00
R4546:Glrb UTSW 3 80879686 missense probably damaging 0.99
R4874:Glrb UTSW 3 80851042 missense possibly damaging 0.84
R5816:Glrb UTSW 3 80861979 missense probably damaging 1.00
R5826:Glrb UTSW 3 80845142 missense probably damaging 0.99
R6711:Glrb UTSW 3 80844974 missense probably benign 0.02
R7738:Glrb UTSW 3 80860184 missense probably damaging 0.98
Z1088:Glrb UTSW 3 80845234 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ACAGCTCTCAAGTTGCATTTTGC -3'
(R):5'- CTTCCCCAGGACTATAGAGTTAAC -3'

Sequencing Primer
(F):5'- TGTCCATGGGAAACAGAGTTAAGTC -3'
(R):5'- CCCAGGACTATAGAGTTAACATTTTC -3'
Posted On2014-06-23