Incidental Mutation 'R1802:Emilin1'
ID203202
Institutional Source Beutler Lab
Gene Symbol Emilin1
Ensembl Gene ENSMUSG00000029163
Gene Nameelastin microfibril interfacer 1
Synonyms5830419M17Rik, gp115, EMILIN-1
MMRRC Submission 039832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1802 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30913402-30921277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30917738 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 441 (P441L)
Ref Sequence ENSEMBL: ENSMUSP00000031055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031053] [ENSMUST00000031055] [ENSMUST00000201571] [ENSMUST00000201621] [ENSMUST00000202752]
Predicted Effect probably benign
Transcript: ENSMUST00000031053
SMART Domains Protein: ENSMUSP00000031053
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 293 5.7e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000031055
AA Change: P441L

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031055
Gene: ENSMUSG00000029163
AA Change: P441L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 57 128 1.2e-19 PFAM
low complexity region 141 155 N/A INTRINSIC
low complexity region 157 171 N/A INTRINSIC
coiled coil region 174 210 N/A INTRINSIC
coiled coil region 237 263 N/A INTRINSIC
coiled coil region 310 342 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
internal_repeat_1 422 474 9.62e-7 PROSPERO
coiled coil region 527 563 N/A INTRINSIC
low complexity region 606 627 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
internal_repeat_1 704 758 9.62e-7 PROSPERO
low complexity region 780 810 N/A INTRINSIC
Pfam:Collagen 813 870 3.3e-10 PFAM
Pfam:C1q 873 1008 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201169
Predicted Effect probably benign
Transcript: ENSMUST00000201571
SMART Domains Protein: ENSMUSP00000144226
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 70 2.4e-5 PFAM
Pfam:PfkB 65 249 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201621
SMART Domains Protein: ENSMUSP00000144050
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 294 1.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202368
Predicted Effect probably benign
Transcript: ENSMUST00000202752
SMART Domains Protein: ENSMUSP00000143850
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 243 5.8e-18 PFAM
Meta Mutation Damage Score 0.0622 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix glycoprotein that is characterized by an N-terminal microfibril interface domain, a coiled-coiled alpha-helical domain, a collagenous domain and a C-terminal globular C1q domain. The encoded protein associates with elastic fibers at the interface between elastin and microfibrils and may play a role in the development of elastic tissues including large blood vessels, dermis, heart and lung. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display no goss abnormalities. However, histological defects occur in the skin and aorta relating to elastin fiber abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik T A 11: 101,988,476 Y25N possibly damaging Het
Abcd2 G T 15: 91,163,102 R583S probably benign Het
Ago2 A T 15: 73,121,180 F492Y probably damaging Het
Ano4 T A 10: 88,981,016 D610V probably damaging Het
Atp6v0d2 A G 4: 19,922,366 probably null Het
Atxn7 T G 14: 14,089,419 S312A probably benign Het
Azgp1 A G 5: 137,985,231 Y56C probably damaging Het
Bcan A G 3: 87,993,108 V606A possibly damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
Ccdc63 T C 5: 122,129,877 R9G probably damaging Het
Cdyl T A 13: 35,872,636 L534* probably null Het
Celf2 T C 2: 6,549,933 E445G probably damaging Het
Cnot8 T C 11: 58,117,535 C276R probably benign Het
Dock4 A G 12: 40,794,598 I1135V possibly damaging Het
Edc3 A G 9: 57,727,315 D205G probably damaging Het
Fancl T G 11: 26,459,709 S188R probably benign Het
Fbn2 T A 18: 58,052,976 K1767* probably null Het
Glrb A T 3: 80,861,957 H154Q probably damaging Het
Gm19965 C T 1: 116,820,903 R105* probably null Het
Grhpr C A 4: 44,988,950 Y202* probably null Het
Herc2 A G 7: 56,184,332 E3095G probably damaging Het
Il22ra2 A T 10: 19,626,699 N89Y probably damaging Het
Itgb6 T C 2: 60,653,281 D261G probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kif1a T A 1: 93,066,149 I360F probably damaging Het
Kmt2d T C 15: 98,862,985 Q828R unknown Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mios T A 6: 8,216,385 Y436* probably null Het
Mprip C T 11: 59,755,041 L684F probably damaging Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Naga C T 15: 82,337,468 R24Q probably benign Het
Nr2c1 G A 10: 94,163,786 V103M possibly damaging Het
Oca2 A G 7: 56,254,980 S65G possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr598 A G 7: 103,328,647 I54V probably benign Het
Phyhipl A T 10: 70,599,025 I28N probably benign Het
Pifo T A 3: 106,014,550 Q19L possibly damaging Het
Pik3cb C A 9: 99,101,289 E89* probably null Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Ppm1a T A 12: 72,793,707 probably null Het
Relt T C 7: 100,850,194 I173V probably damaging Het
Rfx7 T A 9: 72,619,637 S1370T possibly damaging Het
Rps7 G A 12: 28,634,259 R81C probably benign Het
Saa3 T C 7: 46,712,126 *123W probably null Het
Serpina3b C A 12: 104,138,637 H357Q probably damaging Het
Slc9c1 T A 16: 45,558,281 N493K probably benign Het
Spata31 T C 13: 64,922,383 Y782H probably benign Het
Tfap2a T C 13: 40,725,170 D166G probably damaging Het
Thada A T 17: 84,464,407 M9K probably benign Het
Tmem269 A T 4: 119,210,873 probably null Het
Tnxb C A 17: 34,703,889 P2482Q probably damaging Het
Vit T C 17: 78,605,511 V291A possibly damaging Het
Zfp930 G T 8: 69,226,394 A18S possibly damaging Het
Zufsp A T 10: 33,943,718 V200D probably damaging Het
Other mutations in Emilin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Emilin1 APN 5 30913902 missense probably damaging 0.97
IGL01100:Emilin1 APN 5 30918404 missense probably benign
IGL02150:Emilin1 APN 5 30920173 missense possibly damaging 0.85
IGL02416:Emilin1 APN 5 30917788 missense possibly damaging 0.92
IGL02973:Emilin1 APN 5 30920663 missense probably damaging 0.97
R0142:Emilin1 UTSW 5 30913920 missense probably benign 0.00
R0419:Emilin1 UTSW 5 30915022 missense probably damaging 1.00
R1580:Emilin1 UTSW 5 30917420 missense probably damaging 0.99
R1679:Emilin1 UTSW 5 30920199 missense probably benign 0.00
R1803:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R1864:Emilin1 UTSW 5 30918590 missense probably damaging 1.00
R1958:Emilin1 UTSW 5 30917816 missense probably benign 0.03
R2061:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2100:Emilin1 UTSW 5 30917897 missense probably benign 0.01
R2201:Emilin1 UTSW 5 30915692 missense probably benign 0.33
R2206:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2274:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2275:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2285:Emilin1 UTSW 5 30918200 missense probably damaging 1.00
R2851:Emilin1 UTSW 5 30917165 missense probably benign 0.38
R3706:Emilin1 UTSW 5 30917822 missense possibly damaging 0.47
R4205:Emilin1 UTSW 5 30919899 unclassified probably benign
R4865:Emilin1 UTSW 5 30917784 missense possibly damaging 0.93
R4878:Emilin1 UTSW 5 30917066 missense probably benign
R4981:Emilin1 UTSW 5 30919351 missense probably benign
R5113:Emilin1 UTSW 5 30920620 missense possibly damaging 0.73
R5232:Emilin1 UTSW 5 30916979 missense probably benign 0.00
R5853:Emilin1 UTSW 5 30918622 missense probably damaging 0.98
R6358:Emilin1 UTSW 5 30918218 missense probably damaging 0.98
R6807:Emilin1 UTSW 5 30915527 missense probably benign 0.10
R6932:Emilin1 UTSW 5 30917077 missense probably damaging 1.00
R6955:Emilin1 UTSW 5 30917909 missense probably damaging 1.00
R7047:Emilin1 UTSW 5 30917078 missense probably benign 0.05
R7278:Emilin1 UTSW 5 30920660 missense probably benign 0.32
R7305:Emilin1 UTSW 5 30917089 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGGAGGCTAGATGTAGTGACTG -3'
(R):5'- CCAAGGCACTGAGGATCTCATTG -3'

Sequencing Primer
(F):5'- CTGGCTCACTGACAGTGCTAAG -3'
(R):5'- TGAGGATCTCATTGACCCGAGAATC -3'
Posted On2014-06-23