Incidental Mutation 'R1802:Ccdc63'
ID203204
Institutional Source Beutler Lab
Gene Symbol Ccdc63
Ensembl Gene ENSMUSG00000043036
Gene Namecoiled-coil domain containing 63
Synonyms4921511C16Rik
MMRRC Submission 039832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R1802 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location122108040-122140823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122129877 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 9 (R9G)
Ref Sequence ENSEMBL: ENSMUSP00000114804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058960] [ENSMUST00000128101] [ENSMUST00000132701] [ENSMUST00000152389]
Predicted Effect probably damaging
Transcript: ENSMUST00000058960
AA Change: R30G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050582
Gene: ENSMUSG00000043036
AA Change: R30G

DomainStartEndE-ValueType
coiled coil region 140 158 N/A INTRINSIC
coiled coil region 209 285 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
coiled coil region 393 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128101
AA Change: R9G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000132701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146235
Predicted Effect probably damaging
Transcript: ENSMUST00000152389
AA Change: R9G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik T A 11: 101,988,476 Y25N possibly damaging Het
Abcd2 G T 15: 91,163,102 R583S probably benign Het
Ago2 A T 15: 73,121,180 F492Y probably damaging Het
Ano4 T A 10: 88,981,016 D610V probably damaging Het
Atp6v0d2 A G 4: 19,922,366 probably null Het
Atxn7 T G 14: 14,089,419 S312A probably benign Het
Azgp1 A G 5: 137,985,231 Y56C probably damaging Het
Bcan A G 3: 87,993,108 V606A possibly damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
Cdyl T A 13: 35,872,636 L534* probably null Het
Celf2 T C 2: 6,549,933 E445G probably damaging Het
Cnot8 T C 11: 58,117,535 C276R probably benign Het
Dock4 A G 12: 40,794,598 I1135V possibly damaging Het
Edc3 A G 9: 57,727,315 D205G probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Fancl T G 11: 26,459,709 S188R probably benign Het
Fbn2 T A 18: 58,052,976 K1767* probably null Het
Glrb A T 3: 80,861,957 H154Q probably damaging Het
Gm19965 C T 1: 116,820,903 R105* probably null Het
Grhpr C A 4: 44,988,950 Y202* probably null Het
Herc2 A G 7: 56,184,332 E3095G probably damaging Het
Il22ra2 A T 10: 19,626,699 N89Y probably damaging Het
Itgb6 T C 2: 60,653,281 D261G probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kif1a T A 1: 93,066,149 I360F probably damaging Het
Kmt2d T C 15: 98,862,985 Q828R unknown Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mios T A 6: 8,216,385 Y436* probably null Het
Mprip C T 11: 59,755,041 L684F probably damaging Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Naga C T 15: 82,337,468 R24Q probably benign Het
Nr2c1 G A 10: 94,163,786 V103M possibly damaging Het
Oca2 A G 7: 56,254,980 S65G possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr598 A G 7: 103,328,647 I54V probably benign Het
Phyhipl A T 10: 70,599,025 I28N probably benign Het
Pifo T A 3: 106,014,550 Q19L possibly damaging Het
Pik3cb C A 9: 99,101,289 E89* probably null Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Ppm1a T A 12: 72,793,707 probably null Het
Relt T C 7: 100,850,194 I173V probably damaging Het
Rfx7 T A 9: 72,619,637 S1370T possibly damaging Het
Rps7 G A 12: 28,634,259 R81C probably benign Het
Saa3 T C 7: 46,712,126 *123W probably null Het
Serpina3b C A 12: 104,138,637 H357Q probably damaging Het
Slc9c1 T A 16: 45,558,281 N493K probably benign Het
Spata31 T C 13: 64,922,383 Y782H probably benign Het
Tfap2a T C 13: 40,725,170 D166G probably damaging Het
Thada A T 17: 84,464,407 M9K probably benign Het
Tmem269 A T 4: 119,210,873 probably null Het
Tnxb C A 17: 34,703,889 P2482Q probably damaging Het
Vit T C 17: 78,605,511 V291A possibly damaging Het
Zfp930 G T 8: 69,226,394 A18S possibly damaging Het
Zufsp A T 10: 33,943,718 V200D probably damaging Het
Other mutations in Ccdc63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Ccdc63 APN 5 122124919 splice site probably benign
IGL01660:Ccdc63 APN 5 122110964 missense possibly damaging 0.81
IGL01773:Ccdc63 APN 5 122113145 missense possibly damaging 0.93
IGL02341:Ccdc63 APN 5 122113198 missense probably benign 0.00
IGL03030:Ccdc63 APN 5 122122813 missense probably benign 0.00
IGL02991:Ccdc63 UTSW 5 122108212 missense probably benign 0.10
R0267:Ccdc63 UTSW 5 122117044 splice site probably benign
R0961:Ccdc63 UTSW 5 122110946 missense possibly damaging 0.75
R1333:Ccdc63 UTSW 5 122108161 missense probably benign 0.04
R1999:Ccdc63 UTSW 5 122127565 missense possibly damaging 0.72
R2048:Ccdc63 UTSW 5 122130287 critical splice donor site probably null
R2150:Ccdc63 UTSW 5 122127565 missense possibly damaging 0.72
R2350:Ccdc63 UTSW 5 122122885 missense probably benign 0.04
R4049:Ccdc63 UTSW 5 122122750 missense probably damaging 0.99
R5072:Ccdc63 UTSW 5 122121055 missense probably benign 0.28
R5847:Ccdc63 UTSW 5 122116845 missense possibly damaging 0.78
R6031:Ccdc63 UTSW 5 122129736 missense possibly damaging 0.74
R6031:Ccdc63 UTSW 5 122129736 missense possibly damaging 0.74
R6249:Ccdc63 UTSW 5 122124999 missense probably benign 0.17
R6782:Ccdc63 UTSW 5 122111014 nonsense probably null
R7073:Ccdc63 UTSW 5 122111010 missense probably benign 0.00
R7250:Ccdc63 UTSW 5 122122843 missense probably damaging 1.00
R7448:Ccdc63 UTSW 5 122108182 missense probably benign 0.00
R7584:Ccdc63 UTSW 5 122113204 missense possibly damaging 0.73
R7773:Ccdc63 UTSW 5 122109272 missense probably damaging 1.00
R7856:Ccdc63 UTSW 5 122129943 missense probably benign 0.00
R7939:Ccdc63 UTSW 5 122129943 missense probably benign 0.00
X0028:Ccdc63 UTSW 5 122109175 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGGACACCCCTCTTACTATTGGC -3'
(R):5'- GTTTGACTTGTCACCTGGCAG -3'

Sequencing Primer
(F):5'- TACTATTGGCCGGCGATCATACG -3'
(R):5'- GGTCTACCCTACGACAGACAGG -3'
Posted On2014-06-23