Incidental Mutation 'R1802:Olfr598'
ID203213
Institutional Source Beutler Lab
Gene Symbol Olfr598
Ensembl Gene ENSMUSG00000073951
Gene Nameolfactory receptor 598
SynonymsGA_x6K02T2PBJ9-6037823-6038782, MOR23-4P, MOR23-5
MMRRC Submission 039832-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R1802 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103323568-103329888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103328647 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 54 (I54V)
Ref Sequence ENSEMBL: ENSMUSP00000149199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098202] [ENSMUST00000214765]
Predicted Effect probably benign
Transcript: ENSMUST00000098202
AA Change: I54V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000100474
Gene: ENSMUSG00000073951
AA Change: I54V

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 2.3e-89 PFAM
Pfam:7TM_GPCR_Srsx 41 312 9e-7 PFAM
Pfam:7tm_1 47 297 2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214765
AA Change: I54V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik T A 11: 101,988,476 Y25N possibly damaging Het
Abcd2 G T 15: 91,163,102 R583S probably benign Het
Ago2 A T 15: 73,121,180 F492Y probably damaging Het
Ano4 T A 10: 88,981,016 D610V probably damaging Het
Atp6v0d2 A G 4: 19,922,366 probably null Het
Atxn7 T G 14: 14,089,419 S312A probably benign Het
Azgp1 A G 5: 137,985,231 Y56C probably damaging Het
Bcan A G 3: 87,993,108 V606A possibly damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
Ccdc63 T C 5: 122,129,877 R9G probably damaging Het
Cdyl T A 13: 35,872,636 L534* probably null Het
Celf2 T C 2: 6,549,933 E445G probably damaging Het
Cnot8 T C 11: 58,117,535 C276R probably benign Het
Dock4 A G 12: 40,794,598 I1135V possibly damaging Het
Edc3 A G 9: 57,727,315 D205G probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Fancl T G 11: 26,459,709 S188R probably benign Het
Fbn2 T A 18: 58,052,976 K1767* probably null Het
Glrb A T 3: 80,861,957 H154Q probably damaging Het
Gm19965 C T 1: 116,820,903 R105* probably null Het
Grhpr C A 4: 44,988,950 Y202* probably null Het
Herc2 A G 7: 56,184,332 E3095G probably damaging Het
Il22ra2 A T 10: 19,626,699 N89Y probably damaging Het
Itgb6 T C 2: 60,653,281 D261G probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kif1a T A 1: 93,066,149 I360F probably damaging Het
Kmt2d T C 15: 98,862,985 Q828R unknown Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mios T A 6: 8,216,385 Y436* probably null Het
Mprip C T 11: 59,755,041 L684F probably damaging Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Naga C T 15: 82,337,468 R24Q probably benign Het
Nr2c1 G A 10: 94,163,786 V103M possibly damaging Het
Oca2 A G 7: 56,254,980 S65G possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Phyhipl A T 10: 70,599,025 I28N probably benign Het
Pifo T A 3: 106,014,550 Q19L possibly damaging Het
Pik3cb C A 9: 99,101,289 E89* probably null Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Ppm1a T A 12: 72,793,707 probably null Het
Relt T C 7: 100,850,194 I173V probably damaging Het
Rfx7 T A 9: 72,619,637 S1370T possibly damaging Het
Rps7 G A 12: 28,634,259 R81C probably benign Het
Saa3 T C 7: 46,712,126 *123W probably null Het
Serpina3b C A 12: 104,138,637 H357Q probably damaging Het
Slc9c1 T A 16: 45,558,281 N493K probably benign Het
Spata31 T C 13: 64,922,383 Y782H probably benign Het
Tfap2a T C 13: 40,725,170 D166G probably damaging Het
Thada A T 17: 84,464,407 M9K probably benign Het
Tmem269 A T 4: 119,210,873 probably null Het
Tnxb C A 17: 34,703,889 P2482Q probably damaging Het
Vit T C 17: 78,605,511 V291A possibly damaging Het
Zfp930 G T 8: 69,226,394 A18S possibly damaging Het
Zufsp A T 10: 33,943,718 V200D probably damaging Het
Other mutations in Olfr598
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Olfr598 APN 7 103329321 missense probably damaging 1.00
IGL01911:Olfr598 APN 7 103329273 missense probably benign 0.30
IGL02225:Olfr598 APN 7 103329166 missense probably damaging 1.00
IGL02687:Olfr598 APN 7 103329400 nonsense probably null
IGL03214:Olfr598 APN 7 103328666 missense possibly damaging 0.95
R0544:Olfr598 UTSW 7 103328651 missense probably damaging 1.00
R0555:Olfr598 UTSW 7 103328963 missense probably benign
R1081:Olfr598 UTSW 7 103329038 missense probably damaging 1.00
R2092:Olfr598 UTSW 7 103329109 missense probably damaging 1.00
R2197:Olfr598 UTSW 7 103328624 nonsense probably null
R3974:Olfr598 UTSW 7 103329078 missense probably damaging 0.98
R4227:Olfr598 UTSW 7 103328819 missense probably damaging 0.97
R4809:Olfr598 UTSW 7 103328523 nonsense probably null
R4977:Olfr598 UTSW 7 103328833 missense probably benign 0.00
R5324:Olfr598 UTSW 7 103329050 missense probably damaging 1.00
R5478:Olfr598 UTSW 7 103328825 missense probably damaging 1.00
R6238:Olfr598 UTSW 7 103328908 missense possibly damaging 0.95
R6797:Olfr598 UTSW 7 103329121 missense probably benign
R7062:Olfr598 UTSW 7 103329086 missense probably benign 0.10
R7079:Olfr598 UTSW 7 103329184 missense probably benign 0.00
R7539:Olfr598 UTSW 7 103328494 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCAGATATCATGCTCAGTGGTG -3'
(R):5'- ATTGCCAACAGAATGCCGGAC -3'

Sequencing Primer
(F):5'- ATTCCTGGACTAGAGCAC -3'
(R):5'- AGAATGCCGGACTCCATGC -3'
Posted On2014-06-23