Mutagenetix > Incidental Mutations

Incidental Mutation 'R1802:Olfr598'

203213

Institutional Source

Beutler Lab

Gene Symbol

Olfr598

Ensembl Gene

ENSMUSG00000073951

Gene Name

olfactory receptor 598

Synonyms

GA_x6K02T2PBJ9-6037823-6038782, MOR23-4P, MOR23-5

MMRRC Submission

039832-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.271) question?

Stock #

R1802 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103323568-103329888 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103328647 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 54 (I54V)

Ref Sequence

ENSEMBL: ENSMUSP00000149199 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098202] [ENSMUST00000214765]

Predicted Effect

probably benign
Transcript: ENSMUST00000098202
AA Change: I54V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000100474
Gene: ENSMUSG00000073951
AA Change: I54V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	37	315	2.3e-89	PFAM
Pfam:7TM_GPCR_Srsx	41	312	9e-7	PFAM
Pfam:7tm_1	47	297	2e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214765
AA Change: I54V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	T	A	11: 101,988,476	Y25N	possibly damaging	Het
Abcd2	G	T	15: 91,163,102	R583S	probably benign	Het
Ago2	A	T	15: 73,121,180	F492Y	probably damaging	Het
Ano4	T	A	10: 88,981,016	D610V	probably damaging	Het
Atp6v0d2	A	G	4: 19,922,366		probably null	Het
Atxn7	T	G	14: 14,089,419	S312A	probably benign	Het
Azgp1	A	G	5: 137,985,231	Y56C	probably damaging	Het
Bcan	A	G	3: 87,993,108	V606A	possibly damaging	Het
Btnl9	T	A	11: 49,175,790	I335F	probably benign	Het
Ccdc63	T	C	5: 122,129,877	R9G	probably damaging	Het
Cdyl	T	A	13: 35,872,636	L534*	probably null	Het
Celf2	T	C	2: 6,549,933	E445G	probably damaging	Het
Cnot8	T	C	11: 58,117,535	C276R	probably benign	Het
Dock4	A	G	12: 40,794,598	I1135V	possibly damaging	Het
Edc3	A	G	9: 57,727,315	D205G	probably damaging	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Fancl	T	G	11: 26,459,709	S188R	probably benign	Het
Fbn2	T	A	18: 58,052,976	K1767*	probably null	Het
Glrb	A	T	3: 80,861,957	H154Q	probably damaging	Het
Gm19965	C	T	1: 116,820,903	R105*	probably null	Het
Grhpr	C	A	4: 44,988,950	Y202*	probably null	Het
Herc2	A	G	7: 56,184,332	E3095G	probably damaging	Het
Il22ra2	A	T	10: 19,626,699	N89Y	probably damaging	Het
Itgb6	T	C	2: 60,653,281	D261G	probably benign	Het
Jmjd7	C	T	2: 120,030,108	L39F	probably damaging	Het
Kif1a	T	A	1: 93,066,149	I360F	probably damaging	Het
Kmt2d	T	C	15: 98,862,985	Q828R	unknown	Het
March10	C	A	11: 105,389,915	A515S	probably benign	Het
Mios	T	A	6: 8,216,385	Y436*	probably null	Het
Mprip	C	T	11: 59,755,041	L684F	probably damaging	Het
Mybpc2	T	A	7: 44,512,470	N519Y	possibly damaging	Het
Naga	C	T	15: 82,337,468	R24Q	probably benign	Het
Nr2c1	G	A	10: 94,163,786	V103M	possibly damaging	Het
Oca2	A	G	7: 56,254,980	S65G	possibly damaging	Het
Olfr1299	G	T	2: 111,664,754	S176I	probably damaging	Het
Phyhipl	A	T	10: 70,599,025	I28N	probably benign	Het
Pifo	T	A	3: 106,014,550	Q19L	possibly damaging	Het
Pik3cb	C	A	9: 99,101,289	E89*	probably null	Het
Plekhm2	A	T	4: 141,634,347	S262T	probably benign	Het
Ppm1a	T	A	12: 72,793,707		probably null	Het
Relt	T	C	7: 100,850,194	I173V	probably damaging	Het
Rfx7	T	A	9: 72,619,637	S1370T	possibly damaging	Het
Rps7	G	A	12: 28,634,259	R81C	probably benign	Het
Saa3	T	C	7: 46,712,126	*123W	probably null	Het
Serpina3b	C	A	12: 104,138,637	H357Q	probably damaging	Het
Slc9c1	T	A	16: 45,558,281	N493K	probably benign	Het
Spata31	T	C	13: 64,922,383	Y782H	probably benign	Het
Tfap2a	T	C	13: 40,725,170	D166G	probably damaging	Het
Thada	A	T	17: 84,464,407	M9K	probably benign	Het
Tmem269	A	T	4: 119,210,873		probably null	Het
Tnxb	C	A	17: 34,703,889	P2482Q	probably damaging	Het
Vit	T	C	17: 78,605,511	V291A	possibly damaging	Het
Zfp930	G	T	8: 69,226,394	A18S	possibly damaging	Het
Zufsp	A	T	10: 33,943,718	V200D	probably damaging	Het

Other mutations in Olfr598

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Olfr598	APN	7	103329321	missense	probably damaging	1.00
IGL01911:Olfr598	APN	7	103329273	missense	probably benign	0.30
IGL02225:Olfr598	APN	7	103329166	missense	probably damaging	1.00
IGL02687:Olfr598	APN	7	103329400	nonsense	probably null
IGL03214:Olfr598	APN	7	103328666	missense	possibly damaging	0.95
R0544:Olfr598	UTSW	7	103328651	missense	probably damaging	1.00
R0555:Olfr598	UTSW	7	103328963	missense	probably benign
R1081:Olfr598	UTSW	7	103329038	missense	probably damaging	1.00
R2092:Olfr598	UTSW	7	103329109	missense	probably damaging	1.00
R2197:Olfr598	UTSW	7	103328624	nonsense	probably null
R3974:Olfr598	UTSW	7	103329078	missense	probably damaging	0.98
R4227:Olfr598	UTSW	7	103328819	missense	probably damaging	0.97
R4809:Olfr598	UTSW	7	103328523	nonsense	probably null
R4977:Olfr598	UTSW	7	103328833	missense	probably benign	0.00
R5324:Olfr598	UTSW	7	103329050	missense	probably damaging	1.00
R5478:Olfr598	UTSW	7	103328825	missense	probably damaging	1.00
R6238:Olfr598	UTSW	7	103328908	missense	possibly damaging	0.95
R6797:Olfr598	UTSW	7	103329121	missense	probably benign
R7062:Olfr598	UTSW	7	103329086	missense	probably benign	0.10
R7079:Olfr598	UTSW	7	103329184	missense	probably benign	0.00
R7539:Olfr598	UTSW	7	103328494	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTCAGATATCATGCTCAGTGGTG -3'
(R):5'- ATTGCCAACAGAATGCCGGAC -3'

Sequencing Primer
(F):5'- ATTCCTGGACTAGAGCAC -3'
(R):5'- AGAATGCCGGACTCCATGC -3'

Posted On

2014-06-23