Incidental Mutation 'R1802:Phyhipl'
ID203222
Institutional Source Beutler Lab
Gene Symbol Phyhipl
Ensembl Gene ENSMUSG00000037747
Gene Namephytanoyl-CoA hydroxylase interacting protein-like
Synonyms
MMRRC Submission 039832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1802 (G1)
Quality Score216
Status Not validated
Chromosome10
Chromosomal Location70557682-70655965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70599025 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 28 (I28N)
Ref Sequence ENSEMBL: ENSMUSP00000045807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046513] [ENSMUST00000162793]
Predicted Effect probably benign
Transcript: ENSMUST00000046513
AA Change: I28N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045807
Gene: ENSMUSG00000037747
AA Change: I28N

DomainStartEndE-ValueType
FN3 49 142 6.16e-2 SMART
Blast:FN3 188 262 2e-45 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161687
Predicted Effect probably benign
Transcript: ENSMUST00000162144
SMART Domains Protein: ENSMUSP00000124828
Gene: ENSMUSG00000037747

DomainStartEndE-ValueType
FN3 37 130 6.16e-2 SMART
Blast:FN3 176 212 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162571
Predicted Effect probably benign
Transcript: ENSMUST00000162793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163054
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik T A 11: 101,988,476 Y25N possibly damaging Het
Abcd2 G T 15: 91,163,102 R583S probably benign Het
Ago2 A T 15: 73,121,180 F492Y probably damaging Het
Ano4 T A 10: 88,981,016 D610V probably damaging Het
Atp6v0d2 A G 4: 19,922,366 probably null Het
Atxn7 T G 14: 14,089,419 S312A probably benign Het
Azgp1 A G 5: 137,985,231 Y56C probably damaging Het
Bcan A G 3: 87,993,108 V606A possibly damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
Ccdc63 T C 5: 122,129,877 R9G probably damaging Het
Cdyl T A 13: 35,872,636 L534* probably null Het
Celf2 T C 2: 6,549,933 E445G probably damaging Het
Cnot8 T C 11: 58,117,535 C276R probably benign Het
Dock4 A G 12: 40,794,598 I1135V possibly damaging Het
Edc3 A G 9: 57,727,315 D205G probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Fancl T G 11: 26,459,709 S188R probably benign Het
Fbn2 T A 18: 58,052,976 K1767* probably null Het
Glrb A T 3: 80,861,957 H154Q probably damaging Het
Gm19965 C T 1: 116,820,903 R105* probably null Het
Grhpr C A 4: 44,988,950 Y202* probably null Het
Herc2 A G 7: 56,184,332 E3095G probably damaging Het
Il22ra2 A T 10: 19,626,699 N89Y probably damaging Het
Itgb6 T C 2: 60,653,281 D261G probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kif1a T A 1: 93,066,149 I360F probably damaging Het
Kmt2d T C 15: 98,862,985 Q828R unknown Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mios T A 6: 8,216,385 Y436* probably null Het
Mprip C T 11: 59,755,041 L684F probably damaging Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Naga C T 15: 82,337,468 R24Q probably benign Het
Nr2c1 G A 10: 94,163,786 V103M possibly damaging Het
Oca2 A G 7: 56,254,980 S65G possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr598 A G 7: 103,328,647 I54V probably benign Het
Pifo T A 3: 106,014,550 Q19L possibly damaging Het
Pik3cb C A 9: 99,101,289 E89* probably null Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Ppm1a T A 12: 72,793,707 probably null Het
Relt T C 7: 100,850,194 I173V probably damaging Het
Rfx7 T A 9: 72,619,637 S1370T possibly damaging Het
Rps7 G A 12: 28,634,259 R81C probably benign Het
Saa3 T C 7: 46,712,126 *123W probably null Het
Serpina3b C A 12: 104,138,637 H357Q probably damaging Het
Slc9c1 T A 16: 45,558,281 N493K probably benign Het
Spata31 T C 13: 64,922,383 Y782H probably benign Het
Tfap2a T C 13: 40,725,170 D166G probably damaging Het
Thada A T 17: 84,464,407 M9K probably benign Het
Tmem269 A T 4: 119,210,873 probably null Het
Tnxb C A 17: 34,703,889 P2482Q probably damaging Het
Vit T C 17: 78,605,511 V291A possibly damaging Het
Zfp930 G T 8: 69,226,394 A18S possibly damaging Het
Zufsp A T 10: 33,943,718 V200D probably damaging Het
Other mutations in Phyhipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Phyhipl APN 10 70570830 missense probably damaging 1.00
IGL03374:Phyhipl APN 10 70565279 missense possibly damaging 0.47
PIT4366001:Phyhipl UTSW 10 70568958 missense probably benign
R0512:Phyhipl UTSW 10 70568918 missense probably damaging 0.99
R0688:Phyhipl UTSW 10 70559255 missense probably damaging 1.00
R1136:Phyhipl UTSW 10 70569072 missense probably damaging 1.00
R1465:Phyhipl UTSW 10 70570968 missense probably damaging 1.00
R1465:Phyhipl UTSW 10 70570968 missense probably damaging 1.00
R1978:Phyhipl UTSW 10 70559761 missense possibly damaging 0.94
R4077:Phyhipl UTSW 10 70569073 missense probably damaging 1.00
R4960:Phyhipl UTSW 10 70568985 missense probably benign 0.40
R4976:Phyhipl UTSW 10 70569074 missense probably damaging 1.00
R5119:Phyhipl UTSW 10 70569074 missense probably damaging 1.00
R5739:Phyhipl UTSW 10 70559569 missense possibly damaging 0.92
R6303:Phyhipl UTSW 10 70559557 unclassified probably null
R6304:Phyhipl UTSW 10 70559557 unclassified probably null
R6649:Phyhipl UTSW 10 70569013 missense probably damaging 1.00
X0022:Phyhipl UTSW 10 70568961 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAAAGACCAGAGAGGCGCC -3'
(R):5'- ACTCGAAGGAGCTTCTGCC -3'

Sequencing Primer
(F):5'- GCCCTCTTCCCCCAGCAG -3'
(R):5'- GAGGTTGCCCTCGTCCTCAGCCTTCT -3'
Posted On2014-06-23