Incidental Mutation 'R1802:Cnot8'
ID203227
Institutional Source Beutler Lab
Gene Symbol Cnot8
Ensembl Gene ENSMUSG00000020515
Gene NameCCR4-NOT transcription complex, subunit 8
Synonyms
MMRRC Submission 039832-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R1802 (G1)
Quality Score219
Status Not validated
Chromosome11
Chromosomal Location58104153-58118594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58117535 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 276 (C276R)
Ref Sequence ENSEMBL: ENSMUSP00000104471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020822] [ENSMUST00000035604] [ENSMUST00000102711] [ENSMUST00000108843] [ENSMUST00000172035]
Predicted Effect probably benign
Transcript: ENSMUST00000020822
AA Change: C276R

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000020822
Gene: ENSMUSG00000020515
AA Change: C276R

DomainStartEndE-ValueType
Pfam:CAF1 15 139 4.3e-15 PFAM
Pfam:CAF1 138 238 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035604
SMART Domains Protein: ENSMUSP00000036603
Gene: ENSMUSG00000037275

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102711
SMART Domains Protein: ENSMUSP00000099772
Gene: ENSMUSG00000037275

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1063 1083 N/A INTRINSIC
low complexity region 1116 1131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108843
AA Change: C276R

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000104471
Gene: ENSMUSG00000020515
AA Change: C276R

DomainStartEndE-ValueType
Pfam:CAF1 13 240 1.3e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133923
Predicted Effect probably benign
Transcript: ENSMUST00000172035
SMART Domains Protein: ENSMUSP00000131842
Gene: ENSMUSG00000037275

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik T A 11: 101,988,476 Y25N possibly damaging Het
Abcd2 G T 15: 91,163,102 R583S probably benign Het
Ago2 A T 15: 73,121,180 F492Y probably damaging Het
Ano4 T A 10: 88,981,016 D610V probably damaging Het
Atp6v0d2 A G 4: 19,922,366 probably null Het
Atxn7 T G 14: 14,089,419 S312A probably benign Het
Azgp1 A G 5: 137,985,231 Y56C probably damaging Het
Bcan A G 3: 87,993,108 V606A possibly damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
Ccdc63 T C 5: 122,129,877 R9G probably damaging Het
Cdyl T A 13: 35,872,636 L534* probably null Het
Celf2 T C 2: 6,549,933 E445G probably damaging Het
Dock4 A G 12: 40,794,598 I1135V possibly damaging Het
Edc3 A G 9: 57,727,315 D205G probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Fancl T G 11: 26,459,709 S188R probably benign Het
Fbn2 T A 18: 58,052,976 K1767* probably null Het
Glrb A T 3: 80,861,957 H154Q probably damaging Het
Gm19965 C T 1: 116,820,903 R105* probably null Het
Grhpr C A 4: 44,988,950 Y202* probably null Het
Herc2 A G 7: 56,184,332 E3095G probably damaging Het
Il22ra2 A T 10: 19,626,699 N89Y probably damaging Het
Itgb6 T C 2: 60,653,281 D261G probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kif1a T A 1: 93,066,149 I360F probably damaging Het
Kmt2d T C 15: 98,862,985 Q828R unknown Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mios T A 6: 8,216,385 Y436* probably null Het
Mprip C T 11: 59,755,041 L684F probably damaging Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Naga C T 15: 82,337,468 R24Q probably benign Het
Nr2c1 G A 10: 94,163,786 V103M possibly damaging Het
Oca2 A G 7: 56,254,980 S65G possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr598 A G 7: 103,328,647 I54V probably benign Het
Phyhipl A T 10: 70,599,025 I28N probably benign Het
Pifo T A 3: 106,014,550 Q19L possibly damaging Het
Pik3cb C A 9: 99,101,289 E89* probably null Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Ppm1a T A 12: 72,793,707 probably null Het
Relt T C 7: 100,850,194 I173V probably damaging Het
Rfx7 T A 9: 72,619,637 S1370T possibly damaging Het
Rps7 G A 12: 28,634,259 R81C probably benign Het
Saa3 T C 7: 46,712,126 *123W probably null Het
Serpina3b C A 12: 104,138,637 H357Q probably damaging Het
Slc9c1 T A 16: 45,558,281 N493K probably benign Het
Spata31 T C 13: 64,922,383 Y782H probably benign Het
Tfap2a T C 13: 40,725,170 D166G probably damaging Het
Thada A T 17: 84,464,407 M9K probably benign Het
Tmem269 A T 4: 119,210,873 probably null Het
Tnxb C A 17: 34,703,889 P2482Q probably damaging Het
Vit T C 17: 78,605,511 V291A possibly damaging Het
Zfp930 G T 8: 69,226,394 A18S possibly damaging Het
Zufsp A T 10: 33,943,718 V200D probably damaging Het
Other mutations in Cnot8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Cnot8 APN 11 58111362 missense probably damaging 1.00
IGL01774:Cnot8 APN 11 58115307 missense probably benign 0.01
IGL02877:Cnot8 APN 11 58111402 missense probably benign 0.01
straws UTSW 11 58114065 missense probably damaging 1.00
R0465:Cnot8 UTSW 11 58114060 missense probably damaging 0.99
R2418:Cnot8 UTSW 11 58115310 missense probably damaging 1.00
R2419:Cnot8 UTSW 11 58115310 missense probably damaging 1.00
R5199:Cnot8 UTSW 11 58115274 nonsense probably null
R5257:Cnot8 UTSW 11 58117522 missense possibly damaging 0.94
R5317:Cnot8 UTSW 11 58113203 missense probably damaging 1.00
R5351:Cnot8 UTSW 11 58115321 missense probably damaging 1.00
R5702:Cnot8 UTSW 11 58114047 missense possibly damaging 0.71
R6106:Cnot8 UTSW 11 58113990 missense probably damaging 0.96
R6261:Cnot8 UTSW 11 58114051 missense probably damaging 1.00
R6419:Cnot8 UTSW 11 58114065 missense probably damaging 1.00
R6947:Cnot8 UTSW 11 58117505 missense probably benign 0.03
R7070:Cnot8 UTSW 11 58117452 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGGATGTGTACAATGGAGC -3'
(R):5'- TTCAGAGCAAACCCCTCCTG -3'

Sequencing Primer
(F):5'- ACTGTCCAGTGTGCTGTGTCAG -3'
(R):5'- CTCCTGGATCTAAAATAAAGGCATC -3'
Posted On2014-06-23