Incidental Mutation 'R0092:Dip2b'
ID 20323
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 038379-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R0092 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100100146 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1004 (V1004D)
Ref Sequence ENSEMBL: ENSMUSP00000023768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably damaging
Transcript: ENSMUST00000023768
AA Change: V1004D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: V1004D

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: V1238D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: V1238D

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108971
AA Change: V1004D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: V1004D

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230619
Meta Mutation Damage Score 0.5842 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,662,762 (GRCm39) S535T probably benign Het
Acad11 A T 9: 103,967,540 (GRCm39) probably benign Het
Acadm A T 3: 153,647,512 (GRCm39) probably benign Het
Acot12 T A 13: 91,889,684 (GRCm39) M12K probably damaging Het
Actr2 A T 11: 20,044,308 (GRCm39) N99K probably benign Het
Adam2 G A 14: 66,291,336 (GRCm39) A314V probably damaging Het
Agl C T 3: 116,587,453 (GRCm39) R34Q probably damaging Het
Agrn C T 4: 156,263,410 (GRCm39) R338H probably damaging Het
AI661453 A G 17: 47,778,440 (GRCm39) probably benign Het
Alpk3 A G 7: 80,742,301 (GRCm39) D706G probably benign Het
Apbb1 T C 7: 105,208,361 (GRCm39) E648G probably damaging Het
Astn2 C A 4: 66,322,219 (GRCm39) A127S unknown Het
Asxl2 T C 12: 3,546,313 (GRCm39) S366P probably benign Het
Bdh1 A T 16: 31,266,380 (GRCm39) K92* probably null Het
Bltp1 A G 3: 37,082,308 (GRCm39) D3790G probably benign Het
Cacna1g C T 11: 94,348,090 (GRCm39) S666N probably damaging Het
Ces2b A G 8: 105,563,144 (GRCm39) T361A possibly damaging Het
Col6a4 T A 9: 105,890,513 (GRCm39) E1927V probably benign Het
Ctnnb1 T G 9: 120,781,929 (GRCm39) I314S possibly damaging Het
Cyp2c66 T C 19: 39,172,224 (GRCm39) probably benign Het
Dennd4c T A 4: 86,699,844 (GRCm39) F232I probably damaging Het
Dennd5a T C 7: 109,499,013 (GRCm39) N950S possibly damaging Het
Dhx30 T C 9: 109,914,078 (GRCm39) N14S possibly damaging Het
Dnah1 A C 14: 30,993,566 (GRCm39) S2872A probably benign Het
Dnajc10 T C 2: 80,156,026 (GRCm39) V233A probably damaging Het
E230025N22Rik A G 18: 36,822,277 (GRCm39) L162P probably damaging Het
Elmod3 T C 6: 72,543,792 (GRCm39) D333G probably benign Het
Epb41l3 T A 17: 69,593,745 (GRCm39) M846K probably damaging Het
Frem2 A G 3: 53,497,217 (GRCm39) Y1766H probably benign Het
Fxr2 T C 11: 69,532,972 (GRCm39) probably benign Het
Gmpr2 A G 14: 55,915,402 (GRCm39) R258G probably benign Het
Helb T C 10: 119,925,713 (GRCm39) Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,001,899 (GRCm39) probably null Het
Hipk2 T C 6: 38,720,164 (GRCm39) D482G probably damaging Het
Itgb4 G T 11: 115,869,950 (GRCm39) R44L probably damaging Het
Itih1 T C 14: 30,662,820 (GRCm39) probably benign Het
Kit T A 5: 75,808,414 (GRCm39) S719R possibly damaging Het
Krt13 G A 11: 100,012,258 (GRCm39) Q22* probably null Het
L3mbtl4 A C 17: 68,732,698 (GRCm39) R59S probably benign Het
Lpp A G 16: 24,580,352 (GRCm39) S23G probably benign Het
Magi3 G A 3: 103,958,280 (GRCm39) Q602* probably null Het
Man2a1 A G 17: 64,966,079 (GRCm39) probably benign Het
Muc5ac A G 7: 141,372,367 (GRCm39) E2667G possibly damaging Het
Myef2l G A 3: 10,153,633 (GRCm39) C134Y possibly damaging Het
Myo15b C G 11: 115,753,812 (GRCm39) S842C possibly damaging Het
Naf1 T A 8: 67,341,760 (GRCm39) S462T probably benign Het
Necab3 T C 2: 154,400,659 (GRCm39) D34G possibly damaging Het
Nisch C A 14: 30,913,410 (GRCm39) probably benign Het
Nlrc5 T C 8: 95,216,222 (GRCm39) probably benign Het
Nmt1 T C 11: 102,937,319 (GRCm39) F119L probably damaging Het
Nod1 T G 6: 54,921,526 (GRCm39) D264A probably damaging Het
Nol8 C T 13: 49,815,923 (GRCm39) A677V possibly damaging Het
Nt5e T A 9: 88,252,338 (GRCm39) F567I probably benign Het
Obscn A T 11: 58,942,073 (GRCm39) M4434K possibly damaging Het
Opa1 A T 16: 29,444,412 (GRCm39) D866V probably damaging Het
Or10a3m T C 7: 108,313,031 (GRCm39) V145A probably benign Het
Or10al3 T G 17: 38,011,696 (GRCm39) L45R probably damaging Het
Or10p1 A G 10: 129,444,090 (GRCm39) S87P probably damaging Het
Or1j21 A G 2: 36,683,508 (GRCm39) T87A probably benign Het
Or51ai2 T C 7: 103,586,934 (GRCm39) S116P probably damaging Het
Otop1 T A 5: 38,457,174 (GRCm39) V311E probably damaging Het
Pcsk2 A G 2: 143,642,944 (GRCm39) D407G probably damaging Het
Pdcd1 A G 1: 93,980,149 (GRCm39) W23R possibly damaging Het
Pigp A G 16: 94,166,321 (GRCm39) V129A probably damaging Het
Pik3r5 A G 11: 68,383,629 (GRCm39) R483G probably benign Het
Pink1 A G 4: 138,047,309 (GRCm39) V225A probably benign Het
Plcl1 C G 1: 55,735,924 (GRCm39) Q422E probably damaging Het
Plec T C 15: 76,067,943 (GRCm39) E1222G probably benign Het
Polr1a T C 6: 71,944,439 (GRCm39) probably benign Het
Prokr2 C T 2: 132,215,517 (GRCm39) V154M probably damaging Het
Rasgrp4 A G 7: 28,844,557 (GRCm39) R280G possibly damaging Het
Rmnd5b T C 11: 51,520,419 (GRCm39) E8G possibly damaging Het
Sbf2 T A 7: 109,920,013 (GRCm39) probably benign Het
Sec23b A G 2: 144,408,830 (GRCm39) M172V probably benign Het
Setx T C 2: 29,036,305 (GRCm39) V930A probably benign Het
Sft2d2 G A 1: 165,006,829 (GRCm39) A159V possibly damaging Het
Sh3gl1 G T 17: 56,325,088 (GRCm39) R250S probably benign Het
Skor1 C A 9: 63,053,277 (GRCm39) D231Y probably damaging Het
Slc24a1 T G 9: 64,856,034 (GRCm39) E291A unknown Het
Slc28a2b G T 2: 122,348,078 (GRCm39) probably benign Het
Smc1b A T 15: 84,951,925 (GRCm39) probably benign Het
Tbccd1 A T 16: 22,644,844 (GRCm39) N177K possibly damaging Het
Tdp1 T A 12: 99,921,248 (GRCm39) Y595N probably damaging Het
Tle5 G A 10: 81,397,054 (GRCm39) G10D possibly damaging Het
Tmem108 T C 9: 103,366,504 (GRCm39) K496E possibly damaging Het
Tmprss7 T C 16: 45,487,959 (GRCm39) D490G probably damaging Het
Tnrc6b A T 15: 80,802,729 (GRCm39) N1511Y probably damaging Het
Top2b G A 14: 16,409,263 (GRCm38) R802Q probably damaging Het
Trip10 A T 17: 57,557,798 (GRCm39) K27N possibly damaging Het
Txlnb A G 10: 17,718,503 (GRCm39) N445D possibly damaging Het
Txnrd1 T A 10: 82,715,636 (GRCm39) I159N probably damaging Het
Ulk1 C A 5: 110,944,193 (GRCm39) A164S probably null Het
Vmn2r83 T C 10: 79,327,798 (GRCm39) V802A probably damaging Het
Zbtb4 A G 11: 69,670,177 (GRCm39) I967V probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACTAAAGGCCCTCTGCTGTCTC -3'
(R):5'- AGTCCCTGCCATTTACGAGCTATCC -3'

Sequencing Primer
(F):5'- CTGCCCTGCTAGGTACGATG -3'
(R):5'- ccatttacgagctatCCACTCAG -3'
Posted On 2013-04-11