Mutagenetix > Incidental Mutation

Incidental Mutation 'R0092:Lpp'

20325

Institutional Source

Beutler Lab

Gene Symbol

Lpp

Ensembl Gene

ENSMUSG00000033306

Gene Name

LIM domain containing preferred translocation partner in lipoma

Synonyms

B130055L10Rik, 9430020K16Rik

MMRRC Submission

038379-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R0092 (G1)

Quality Score

195

Status

Validated (trace)

Chromosome

Chromosomal Location

24393507-24992578 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24761602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 23 (S23G)

Ref Sequence

ENSEMBL: ENSMUSP00000110969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038053] [ENSMUST00000078988] [ENSMUST00000115314]

AlphaFold

Q8BFW7

Predicted Effect

probably benign
Transcript: ENSMUST00000038053
AA Change: S148G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000036304
Gene: ENSMUSG00000033306
AA Change: S148G

Domain	Start	End	E-Value	Type
low complexity region	41	55	N/A	INTRINSIC
low complexity region	61	93	N/A	INTRINSIC
coiled coil region	109	134	N/A	INTRINSIC
low complexity region	174	197	N/A	INTRINSIC
low complexity region	255	267	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC
LIM	416	469	1.03e-16	SMART
LIM	476	528	1.94e-12	SMART
LIM	536	597	2.5e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000078988
AA Change: S148G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000078005
Gene: ENSMUSG00000033306
AA Change: S148G

Domain	Start	End	E-Value	Type
low complexity region	41	55	N/A	INTRINSIC
low complexity region	61	93	N/A	INTRINSIC
coiled coil region	109	134	N/A	INTRINSIC
low complexity region	174	197	N/A	INTRINSIC
low complexity region	255	267	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC
LIM	416	469	1.03e-16	SMART
LIM	476	528	1.94e-12	SMART
LIM	536	597	2.5e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115314
AA Change: S23G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000110969
Gene: ENSMUSG00000033306
AA Change: S23G

Domain	Start	End	E-Value	Type
low complexity region	49	72	N/A	INTRINSIC
low complexity region	130	142	N/A	INTRINSIC
low complexity region	246	261	N/A	INTRINSIC
LIM	291	344	1.03e-16	SMART
LIM	351	403	1.94e-12	SMART
LIM	411	472	2.5e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231279

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.1%
20x: 88.6%

Validation Efficiency

99% (112/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM domain proteins that are characterized by an N-terminal proline-rich region and three C-terminal LIM domains. The encoded protein localizes to the cell periphery in focal adhesions and may be involved in cell-cell adhesion and cell motility. This protein also shuttles through the nucleus and may function as a transcriptional co-activator. This gene is located at the junction of certain disease-related chromosomal translocations, which result in the expression of chimeric proteins that may promote tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Gene disruption results in fertility problems involving females but not males. Migration and survival of MEFs are also abnormal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 37,028,159	D3790G	probably benign	Het
Abcg2	T	A	6: 58,685,777	S535T	probably benign	Het
Acad11	A	T	9: 104,090,341		probably benign	Het
Acadm	A	T	3: 153,941,875		probably benign	Het
Acot12	T	A	13: 91,741,565	M12K	probably damaging	Het
Actr2	A	T	11: 20,094,308	N99K	probably benign	Het
Adam2	G	A	14: 66,053,887	A314V	probably damaging	Het
Aes	G	A	10: 81,561,220	G10D	possibly damaging	Het
Agl	C	T	3: 116,793,804	R34Q	probably damaging	Het
Agrn	C	T	4: 156,178,953	R338H	probably damaging	Het
AI661453	A	G	17: 47,467,515		probably benign	Het
Alpk3	A	G	7: 81,092,553	D706G	probably benign	Het
Apbb1	T	C	7: 105,559,154	E648G	probably damaging	Het
Astn2	C	A	4: 66,403,982	A127S	unknown	Het
Asxl2	T	C	12: 3,496,313	S366P	probably benign	Het
Bdh1	A	T	16: 31,447,562	K92*	probably null	Het
Cacna1g	C	T	11: 94,457,264	S666N	probably damaging	Het
Ces2b	A	G	8: 104,836,512	T361A	possibly damaging	Het
Col6a4	T	A	9: 106,013,314	E1927V	probably benign	Het
Ctnnb1	T	G	9: 120,952,863	I314S	possibly damaging	Het
Cyp2c66	T	C	19: 39,183,780		probably benign	Het
Dennd4c	T	A	4: 86,781,607	F232I	probably damaging	Het
Dennd5a	T	C	7: 109,899,806	N950S	possibly damaging	Het
Dhx30	T	C	9: 110,085,010	N14S	possibly damaging	Het
Dip2b	T	A	15: 100,202,265	V1004D	probably damaging	Het
Dnah1	A	C	14: 31,271,609	S2872A	probably benign	Het
Dnajc10	T	C	2: 80,325,682	V233A	probably damaging	Het
E230025N22Rik	A	G	18: 36,689,224	L162P	probably damaging	Het
Elmod3	T	C	6: 72,566,809	D333G	probably benign	Het
Epb41l3	T	A	17: 69,286,750	M846K	probably damaging	Het
Frem2	A	G	3: 53,589,796	Y1766H	probably benign	Het
Fxr2	T	C	11: 69,642,146		probably benign	Het
Gm14085	G	T	2: 122,517,597		probably benign	Het
Gm9833	G	A	3: 10,088,573	C134Y	possibly damaging	Het
Gmpr2	A	G	14: 55,677,945	R258G	probably benign	Het
Helb	T	C	10: 120,089,808	Y888C	probably damaging	Het
Hephl1	TTCCAGATGTCC	TTCC	9: 15,090,603		probably null	Het
Hipk2	T	C	6: 38,743,229	D482G	probably damaging	Het
Itgb4	G	T	11: 115,979,124	R44L	probably damaging	Het
Itih1	T	C	14: 30,940,863		probably benign	Het
Kit	T	A	5: 75,647,754	S719R	possibly damaging	Het
Krt13	G	A	11: 100,121,432	Q22*	probably null	Het
L3mbtl4	A	C	17: 68,425,703	R59S	probably benign	Het
Magi3	G	A	3: 104,050,964	Q602*	probably null	Het
Man2a1	A	G	17: 64,659,084		probably benign	Het
Muc5ac	A	G	7: 141,818,630	E2667G	possibly damaging	Het
Myo15b	C	G	11: 115,862,986	S842C	possibly damaging	Het
Naf1	T	A	8: 66,889,108	S462T	probably benign	Het
Necab3	T	C	2: 154,558,739	D34G	possibly damaging	Het
Nisch	C	A	14: 31,191,453		probably benign	Het
Nlrc5	T	C	8: 94,489,594		probably benign	Het
Nmt1	T	C	11: 103,046,493	F119L	probably damaging	Het
Nod1	T	G	6: 54,944,541	D264A	probably damaging	Het
Nol8	C	T	13: 49,662,447	A677V	possibly damaging	Het
Nt5e	T	A	9: 88,370,285	F567I	probably benign	Het
Obscn	A	T	11: 59,051,247	M4434K	possibly damaging	Het
Olfr119	T	G	17: 37,700,805	L45R	probably damaging	Het
Olfr50	A	G	2: 36,793,496	T87A	probably benign	Het
Olfr512	T	C	7: 108,713,824	V145A	probably benign	Het
Olfr632	T	C	7: 103,937,727	S116P	probably damaging	Het
Olfr796	A	G	10: 129,608,221	S87P	probably damaging	Het
Opa1	A	T	16: 29,625,594	D866V	probably damaging	Het
Otop1	T	A	5: 38,299,830	V311E	probably damaging	Het
Pcsk2	A	G	2: 143,801,024	D407G	probably damaging	Het
Pdcd1	A	G	1: 94,052,424	W23R	possibly damaging	Het
Pigp	A	G	16: 94,365,462	V129A	probably damaging	Het
Pik3r5	A	G	11: 68,492,803	R483G	probably benign	Het
Pink1	A	G	4: 138,319,998	V225A	probably benign	Het
Plcl1	C	G	1: 55,696,765	Q422E	probably damaging	Het
Plec	T	C	15: 76,183,743	E1222G	probably benign	Het
Polr1a	T	C	6: 71,967,455		probably benign	Het
Prokr2	C	T	2: 132,373,597	V154M	probably damaging	Het
Rasgrp4	A	G	7: 29,145,132	R280G	possibly damaging	Het
Rmnd5b	T	C	11: 51,629,592	E8G	possibly damaging	Het
Sbf2	T	A	7: 110,320,806		probably benign	Het
Sec23b	A	G	2: 144,566,910	M172V	probably benign	Het
Setx	T	C	2: 29,146,293	V930A	probably benign	Het
Sft2d2	G	A	1: 165,179,260	A159V	possibly damaging	Het
Sh3gl1	G	T	17: 56,018,088	R250S	probably benign	Het
Skor1	C	A	9: 63,145,995	D231Y	probably damaging	Het
Slc24a1	T	G	9: 64,948,752	E291A	unknown	Het
Smc1b	A	T	15: 85,067,724		probably benign	Het
Tbccd1	A	T	16: 22,826,094	N177K	possibly damaging	Het
Tdp1	T	A	12: 99,954,989	Y595N	probably damaging	Het
Tmem108	T	C	9: 103,489,305	K496E	possibly damaging	Het
Tmprss7	T	C	16: 45,667,596	D490G	probably damaging	Het
Tnrc6b	A	T	15: 80,918,528	N1511Y	probably damaging	Het
Top2b	G	A	14: 16,409,263	R802Q	probably damaging	Het
Trip10	A	T	17: 57,250,798	K27N	possibly damaging	Het
Txlnb	A	G	10: 17,842,755	N445D	possibly damaging	Het
Txnrd1	T	A	10: 82,879,802	I159N	probably damaging	Het
Ulk1	C	A	5: 110,796,327	A164S	probably null	Het
Vmn2r83	T	C	10: 79,491,964	V802A	probably damaging	Het
Zbtb4	A	G	11: 69,779,351	I967V	probably benign	Het

Other mutations in Lpp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00588:Lpp	APN	16	24845188	missense	probably damaging	1.00
IGL01354:Lpp	APN	16	24762066	nonsense	probably null
IGL02141:Lpp	APN	16	24761615	missense	probably damaging	0.98
IGL02182:Lpp	APN	16	24762145	missense	probably damaging	0.99
IGL02230:Lpp	APN	16	24762145	missense	probably damaging	0.99
IGL02232:Lpp	APN	16	24762145	missense	probably damaging	0.99
IGL02234:Lpp	APN	16	24762145	missense	probably damaging	0.99
IGL02236:Lpp	APN	16	24762145	missense	probably damaging	0.99
IGL02371:Lpp	APN	16	24761611	missense	probably damaging	0.96
IGL03265:Lpp	APN	16	24761987	missense	probably damaging	1.00
PIT4585001:Lpp	UTSW	16	24761947	missense	probably benign	0.23
R0047:Lpp	UTSW	16	24661800	splice site	probably benign
R0047:Lpp	UTSW	16	24661800	splice site	probably benign
R0385:Lpp	UTSW	16	24761837	missense	probably damaging	1.00
R0389:Lpp	UTSW	16	24608241	missense	probably damaging	1.00
R0504:Lpp	UTSW	16	24971970	missense	probably damaging	1.00
R0798:Lpp	UTSW	16	24971872	nonsense	probably null
R1199:Lpp	UTSW	16	24681860	missense	probably damaging	1.00
R1581:Lpp	UTSW	16	24681841	nonsense	probably null
R1755:Lpp	UTSW	16	24845124	missense	probably benign
R1848:Lpp	UTSW	16	24761655	missense	probably damaging	1.00
R1980:Lpp	UTSW	16	24661701	missense	probably damaging	1.00
R3432:Lpp	UTSW	16	24889886	missense	probably benign	0.04
R3755:Lpp	UTSW	16	24845161	missense	probably benign	0.00
R4078:Lpp	UTSW	16	24681861	missense	probably damaging	1.00
R4214:Lpp	UTSW	16	24762054	nonsense	probably null
R4712:Lpp	UTSW	16	24761657	missense	possibly damaging	0.94
R4806:Lpp	UTSW	16	24661680	missense	probably damaging	0.97
R4968:Lpp	UTSW	16	24979314	missense	probably damaging	1.00
R5047:Lpp	UTSW	16	24971846	missense	probably damaging	1.00
R5371:Lpp	UTSW	16	24889804	missense	probably damaging	1.00
R5536:Lpp	UTSW	16	24845206	missense	possibly damaging	0.54
R5875:Lpp	UTSW	16	24608309	missense	probably benign	0.10
R7285:Lpp	UTSW	16	24977279	missense	probably damaging	1.00
R7587:Lpp	UTSW	16	24762279	splice site	probably null
R7846:Lpp	UTSW	16	24608126	start codon destroyed	probably null	0.98
R9065:Lpp	UTSW	16	24762139	missense	probably benign	0.03
R9378:Lpp	UTSW	16	24721987	start codon destroyed	probably benign	0.00
R9616:Lpp	UTSW	16	24761969	missense	probably benign
Z1176:Lpp	UTSW	16	24761603	missense	probably benign	0.00
Z1177:Lpp	UTSW	16	24661712	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTGTGGAGAGCGTTTCAAAATGAT -3'
(R):5'- AGGAGGCTGGAACTGGCTGA -3'

Sequencing Primer
(F):5'- cctttcatcactgtctttgttttc -3'
(R):5'- AACTGGCTGAGGCTGGG -3'

Posted On

2013-04-11