Incidental Mutation 'R1803:Stard9'
ID203260
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene NameSTART domain containing 9
SynonymsE230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
MMRRC Submission 039833-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R1803 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120629121-120731895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120701489 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 2742 (E2742D)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]
Predicted Effect unknown
Transcript: ENSMUST00000070420
AA Change: E49D
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705
AA Change: E49D

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154193
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180041
AA Change: E2742D

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: E2742D

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A T 17: 79,627,666 probably benign Het
9330182L06Rik A G 5: 9,427,832 H410R probably benign Het
Adgrl3 C T 5: 81,771,617 R586* probably null Het
Arpp21 T C 9: 112,127,398 T471A possibly damaging Het
Blnk T C 19: 40,952,377 E194G probably damaging Het
Cd44 G A 2: 102,834,252 P332S probably damaging Het
Cd47 T C 16: 49,867,806 F30L possibly damaging Het
Cdh23 T C 10: 60,331,281 E1861G probably damaging Het
Cdkal1 T A 13: 29,517,471 M332L probably damaging Het
Cul9 A G 17: 46,503,097 S2284P probably damaging Het
Cyp2a5 G T 7: 26,835,546 probably null Het
Dcp2 T C 18: 44,395,917 I33T probably damaging Het
Ddx52 A T 11: 83,946,132 I150L probably damaging Het
Ddx58 A G 4: 40,224,013 S289P probably benign Het
Dennd5a T A 7: 109,898,613 T1067S probably benign Het
Dnpep A T 1: 75,309,414 L419* probably null Het
Dock8 A G 19: 25,132,235 K927R probably benign Het
Dpy19l4 A T 4: 11,281,020 V475E possibly damaging Het
Edf1 C T 2: 25,560,194 S41F probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha3 T C 16: 63,602,288 K579E probably benign Het
Exoc1 A G 5: 76,561,441 N23S probably benign Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Flt3 C A 5: 147,367,055 E358* probably null Het
Fzd1 A T 5: 4,756,385 I399K probably damaging Het
Gdi2 T A 13: 3,564,547 Y333* probably null Het
Gm10479 A G 12: 20,433,653 H91R probably benign Het
Gm10842 G A 11: 105,147,041 R50K unknown Het
Grin2c A T 11: 115,260,732 probably null Het
Grk2 C T 19: 4,294,883 V53M probably damaging Het
H2-M10.2 C T 17: 36,285,871 M104I probably benign Het
Hyou1 C T 9: 44,384,182 Q290* probably null Het
Itgb2 T C 10: 77,564,790 S746P probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl2 T C 8: 64,759,797 E236G probably damaging Het
Krtap19-4 C A 16: 88,884,991 G26C unknown Het
Krtap4-16 G A 11: 99,851,172 T134I possibly damaging Het
Lamb2 A G 9: 108,488,099 H1318R probably benign Het
Mab21l3 G A 3: 101,835,130 T38M probably benign Het
Mfsd10 A T 5: 34,636,750 D6E possibly damaging Het
Mnat1 G T 12: 73,179,233 G91* probably null Het
Mns1 A T 9: 72,452,734 I389F probably damaging Het
Morc1 A T 16: 48,622,638 T829S probably benign Het
Morn5 T A 2: 36,053,077 V63E probably benign Het
Mybpc1 T C 10: 88,553,295 T404A possibly damaging Het
Npc1l1 A T 11: 6,228,846 M188K probably damaging Het
Nrcam T A 12: 44,572,208 M846K probably benign Het
Nup210 A C 6: 91,074,282 F373C probably damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1465 A T 19: 13,314,171 V38E possibly damaging Het
Olfr830 T C 9: 18,876,080 V248A probably damaging Het
Osbpl8 T C 10: 111,275,049 S471P probably damaging Het
Plekhn1 A T 4: 156,222,381 I517N probably benign Het
Plin4 G T 17: 56,104,931 T700K probably damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Prdm16 A T 4: 154,335,261 M897K probably damaging Het
Ptprg T A 14: 12,091,410 probably null Het
Rcan2 G T 17: 44,037,033 C211F probably damaging Het
Rxfp1 C T 3: 79,737,769 C9Y probably benign Het
Scn2a G A 2: 65,670,767 probably null Het
Scnn1a A C 6: 125,332,194 R264S probably damaging Het
Sema4g T C 19: 44,998,020 V345A probably benign Het
Sgo2b T A 8: 63,927,392 D802V probably benign Het
Slc25a21 G A 12: 56,858,087 T54I probably benign Het
Slc25a46 C T 18: 31,594,588 E223K probably damaging Het
Slc25a54 A G 3: 109,102,697 I171V probably benign Het
Slc7a6 T C 8: 106,192,456 V224A possibly damaging Het
Smchd1 A T 17: 71,387,006 V1248E probably damaging Het
Sort1 C A 3: 108,325,699 F196L probably damaging Het
Sptbn4 G A 7: 27,418,583 T357M probably damaging Het
Srrm3 T A 5: 135,857,129 W308R probably damaging Het
Tas1r1 T A 4: 152,032,248 I310F probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tff1 A T 17: 31,161,586 C85* probably null Het
Tlr11 C T 14: 50,360,647 T30I probably benign Het
Trio T C 15: 27,748,340 T1265A probably benign Het
Ttc7b T C 12: 100,407,002 M338V possibly damaging Het
Umod T A 7: 119,464,724 S620C probably damaging Het
Ust C A 10: 8,298,055 probably null Het
Vmn1r176 A T 7: 23,835,184 S181R probably damaging Het
Vmn1r202 T C 13: 22,502,143 T35A probably benign Het
Vmn1r39 C A 6: 66,804,911 R104L probably benign Het
Vps13b T A 15: 35,430,205 Y286* probably null Het
Zfp579 G A 7: 4,993,770 R381C probably damaging Het
Zfp85 A G 13: 67,751,628 S71P probably benign Het
Zfyve16 A T 13: 92,504,085 V1254E probably damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120701847 missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120698479 missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120698719 missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120701368 missense probably benign 0.04
IGL01394:Stard9 APN 2 120706327 missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120673604 missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120703330 missense probably damaging 1.00
IGL01810:Stard9 APN 2 120699084 missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120706446 missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120668016 missense probably damaging 1.00
IGL02031:Stard9 APN 2 120702339 missense probably benign 0.27
IGL02081:Stard9 APN 2 120664910 missense probably damaging 0.98
IGL02558:Stard9 APN 2 120696907 missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120698992 missense probably damaging 1.00
IGL02873:Stard9 APN 2 120713807 missense probably damaging 1.00
IGL03195:Stard9 APN 2 120705802 missense probably damaging 1.00
IGL03204:Stard9 APN 2 120705802 missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120696085 small insertion probably benign
IGL03014:Stard9 UTSW 2 120702194 unclassified probably benign
PIT4151001:Stard9 UTSW 2 120702756 nonsense probably null
PIT4498001:Stard9 UTSW 2 120697435 missense possibly damaging 0.86
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0038:Stard9 UTSW 2 120695832 missense probably benign
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0116:Stard9 UTSW 2 120634255 missense probably damaging 0.99
R0398:Stard9 UTSW 2 120696307 missense probably benign 0.03
R0479:Stard9 UTSW 2 120697596 missense probably damaging 1.00
R0556:Stard9 UTSW 2 120698923 missense probably benign 0.09
R0589:Stard9 UTSW 2 120698547 missense probably benign 0.00
R0609:Stard9 UTSW 2 120706306 missense probably damaging 1.00
R0611:Stard9 UTSW 2 120699257 missense probably benign 0.00
R0683:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0751:Stard9 UTSW 2 120697485 missense probably benign 0.04
R0833:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120700842 missense probably damaging 1.00
R0848:Stard9 UTSW 2 120695823 missense probably damaging 1.00
R0849:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0961:Stard9 UTSW 2 120693439 missense probably benign 0.01
R0993:Stard9 UTSW 2 120705169 missense probably damaging 1.00
R1005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1006:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1115:Stard9 UTSW 2 120692850 missense probably benign 0.05
R1163:Stard9 UTSW 2 120696213 missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1200:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1331:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1332:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1333:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1334:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1335:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1336:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1338:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1346:Stard9 UTSW 2 120713448 missense probably damaging 1.00
R1370:Stard9 UTSW 2 120697477 missense probably benign 0.11
R1384:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1401:Stard9 UTSW 2 120712847 splice site probably benign
R1416:Stard9 UTSW 2 120700972 missense probably benign 0.00
R1453:Stard9 UTSW 2 120666376 missense probably damaging 1.00
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120702052 missense probably benign 0.09
R1538:Stard9 UTSW 2 120696711 missense probably benign 0.25
R1614:Stard9 UTSW 2 120697675 missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120703722 missense probably benign 0.37
R1658:Stard9 UTSW 2 120701542 missense probably benign 0.02
R1686:Stard9 UTSW 2 120699492 missense probably benign 0.00
R1797:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1806:Stard9 UTSW 2 120679453 splice site probably null
R1847:Stard9 UTSW 2 120698489 missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120688751 missense probably damaging 1.00
R1892:Stard9 UTSW 2 120693708 missense probably benign 0.01
R1906:Stard9 UTSW 2 120696427 missense probably benign 0.00
R1907:Stard9 UTSW 2 120713812 missense probably damaging 1.00
R1930:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1933:Stard9 UTSW 2 120698656 missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120701406 missense probably benign
R1999:Stard9 UTSW 2 120692868 missense probably damaging 0.99
R2004:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2005:Stard9 UTSW 2 120664945 missense possibly damaging 0.90
R2005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2021:Stard9 UTSW 2 120704235 missense probably benign 0.05
R2025:Stard9 UTSW 2 120702398 missense probably benign 0.20
R2190:Stard9 UTSW 2 120714120 missense probably benign 0.22
R2204:Stard9 UTSW 2 120698531 frame shift probably null
R2422:Stard9 UTSW 2 120700284 missense probably benign 0.29
R3401:Stard9 UTSW 2 120703689 missense probably damaging 0.98
R3618:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120713549 missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120698229 missense probably benign 0.11
R4022:Stard9 UTSW 2 120704155 missense probably benign 0.05
R4223:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120701946 missense probably benign 0.43
R4382:Stard9 UTSW 2 120634222 missense probably damaging 1.00
R4453:Stard9 UTSW 2 120697791 missense probably benign
R4499:Stard9 UTSW 2 120700241 missense probably benign 0.05
R4524:Stard9 UTSW 2 120696445 missense probably damaging 1.00
R4671:Stard9 UTSW 2 120698640 missense probably damaging 0.98
R4701:Stard9 UTSW 2 120705713 missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120696123 missense probably benign 0.01
R4822:Stard9 UTSW 2 120695941 missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120703113 missense probably benign 0.18
R4863:Stard9 UTSW 2 120700860 missense probably benign 0.00
R4898:Stard9 UTSW 2 120706419 nonsense probably null
R5033:Stard9 UTSW 2 120693399 missense probably benign 0.00
R5087:Stard9 UTSW 2 120697019 nonsense probably null
R5157:Stard9 UTSW 2 120697861 missense probably benign
R5213:Stard9 UTSW 2 120699226 missense probably damaging 1.00
R5237:Stard9 UTSW 2 120699358 missense probably damaging 0.96
R5257:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5258:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5273:Stard9 UTSW 2 120705087 missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120701947 missense probably benign 0.43
R5288:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5292:Stard9 UTSW 2 120699145 missense probably benign 0.17
R5328:Stard9 UTSW 2 120699230 missense probably damaging 1.00
R5385:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5386:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5393:Stard9 UTSW 2 120702906 missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120693668 missense probably benign 0.17
R5685:Stard9 UTSW 2 120705322 missense probably damaging 1.00
R5749:Stard9 UTSW 2 120703786 missense probably damaging 1.00
R5780:Stard9 UTSW 2 120703396 missense probably benign 0.02
R5901:Stard9 UTSW 2 120701370 missense probably damaging 1.00
R5941:Stard9 UTSW 2 120713558 missense probably damaging 1.00
R5960:Stard9 UTSW 2 120699961 missense probably benign 0.05
R5966:Stard9 UTSW 2 120697099 missense probably damaging 1.00
R5967:Stard9 UTSW 2 120706894 missense probably damaging 0.99
R6012:Stard9 UTSW 2 120704586 missense probably damaging 1.00
R6019:Stard9 UTSW 2 120693715 frame shift probably null
R6020:Stard9 UTSW 2 120693715 frame shift probably null
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6090:Stard9 UTSW 2 120693654 missense probably damaging 0.99
R6192:Stard9 UTSW 2 120696760 missense probably damaging 0.99
R6228:Stard9 UTSW 2 120713750 missense probably damaging 1.00
R6235:Stard9 UTSW 2 120713546 missense probably damaging 1.00
R6280:Stard9 UTSW 2 120701127 missense probably benign
R6338:Stard9 UTSW 2 120697485 missense probably benign
R6344:Stard9 UTSW 2 120704320 missense probably benign 0.12
R6364:Stard9 UTSW 2 120713429 missense probably damaging 1.00
R6383:Stard9 UTSW 2 120666407 critical splice donor site probably null
R6644:Stard9 UTSW 2 120695772 missense probably benign 0.11
R6747:Stard9 UTSW 2 120698383 missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120701259 missense probably damaging 1.00
R6836:Stard9 UTSW 2 120699843 missense probably benign 0.15
R6861:Stard9 UTSW 2 120705186 missense probably benign 0.09
R6872:Stard9 UTSW 2 120714068 nonsense probably null
R6875:Stard9 UTSW 2 120697436 missense probably benign 0.04
R6915:Stard9 UTSW 2 120702630 missense probably benign 0.00
R6934:Stard9 UTSW 2 120697695 missense probably benign 0.00
R6943:Stard9 UTSW 2 120702196 missense probably benign 0.29
R7009:Stard9 UTSW 2 120697191 missense probably benign 0.37
R7031:Stard9 UTSW 2 120700450 missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120679378 nonsense probably null
R7151:Stard9 UTSW 2 120696142 missense probably benign
R7154:Stard9 UTSW 2 120701314 missense probably benign 0.00
R7154:Stard9 UTSW 2 120704542 missense probably benign 0.02
R7165:Stard9 UTSW 2 120704158 missense probably damaging 1.00
R7260:Stard9 UTSW 2 120706938 missense possibly damaging 0.90
R7270:Stard9 UTSW 2 120634274 nonsense probably null
R7282:Stard9 UTSW 2 120698503 missense probably benign 0.00
R7344:Stard9 UTSW 2 120704686 missense possibly damaging 0.90
R7347:Stard9 UTSW 2 120666534 missense probably benign
R7359:Stard9 UTSW 2 120698280 missense probably damaging 1.00
R7410:Stard9 UTSW 2 120701497 missense probably benign 0.41
R7422:Stard9 UTSW 2 120702152 missense probably benign 0.21
R7475:Stard9 UTSW 2 120688110 missense probably damaging 1.00
R7523:Stard9 UTSW 2 120699597 missense probably benign
R7553:Stard9 UTSW 2 120693808 splice site probably null
X0023:Stard9 UTSW 2 120702744 missense probably benign 0.00
X0023:Stard9 UTSW 2 120702963 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTGGGATCAGAGAAAGTGTCTG -3'
(R):5'- GATGCCGTATGTTAGCTTCTGC -3'

Sequencing Primer
(F):5'- GGATCAGAGAAAGTGTCTGTCTTACC -3'
(R):5'- GCTTCTGCTCCAACATTTCCTGG -3'
Posted On2014-06-23