Mutagenetix > Incidental Mutations

Incidental Mutation 'R1803:Rxfp1'

203261

Institutional Source

Beutler Lab

Gene Symbol

Rxfp1

Ensembl Gene

ENSMUSG00000034009

Gene Name

relaxin/insulin-like family peptide receptor 1

Synonyms

Lgr7, LOC381489

MMRRC Submission

039833-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.219) question?

Stock #

R1803 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79641611-79737880 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 79737769 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 9 (C9Y)

Ref Sequence

ENSEMBL: ENSMUSP00000138578 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]

Predicted Effect

probably benign
Transcript: ENSMUST00000078527
AA Change: C9Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: C9Y

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART
LRRNT	101	130	9.51e-1	SMART
LRR	126	148	3.65e1	SMART
LRR	149	172	1.19e1	SMART
LRR_TYP	173	196	4.61e-5	SMART
LRR	197	220	1.86e0	SMART
LRR	221	244	1.86e2	SMART
LRR	246	269	2.03e1	SMART
LRR	270	293	1.76e2	SMART
LRR_TYP	294	317	4.24e-4	SMART
LRR	318	341	1.15e1	SMART
LRR	342	365	3.65e1	SMART
Pfam:7tm_1	422	681	2.8e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182491
AA Change: C9Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009
AA Change: C9Y

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513D11Rik	A	T	17: 79,627,666		probably benign	Het
9330182L06Rik	A	G	5: 9,427,832	H410R	probably benign	Het
Adgrl3	C	T	5: 81,771,617	R586*	probably null	Het
Arpp21	T	C	9: 112,127,398	T471A	possibly damaging	Het
Blnk	T	C	19: 40,952,377	E194G	probably damaging	Het
Cd44	G	A	2: 102,834,252	P332S	probably damaging	Het
Cd47	T	C	16: 49,867,806	F30L	possibly damaging	Het
Cdh23	T	C	10: 60,331,281	E1861G	probably damaging	Het
Cdkal1	T	A	13: 29,517,471	M332L	probably damaging	Het
Cul9	A	G	17: 46,503,097	S2284P	probably damaging	Het
Cyp2a5	G	T	7: 26,835,546		probably null	Het
Dcp2	T	C	18: 44,395,917	I33T	probably damaging	Het
Ddx52	A	T	11: 83,946,132	I150L	probably damaging	Het
Ddx58	A	G	4: 40,224,013	S289P	probably benign	Het
Dennd5a	T	A	7: 109,898,613	T1067S	probably benign	Het
Dnpep	A	T	1: 75,309,414	L419*	probably null	Het
Dock8	A	G	19: 25,132,235	K927R	probably benign	Het
Dpy19l4	A	T	4: 11,281,020	V475E	possibly damaging	Het
Edf1	C	T	2: 25,560,194	S41F	probably damaging	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Epha3	T	C	16: 63,602,288	K579E	probably benign	Het
Exoc1	A	G	5: 76,561,441	N23S	probably benign	Het
Fam212a	A	G	9: 107,984,739	V128A	probably benign	Het
Flt3	C	A	5: 147,367,055	E358*	probably null	Het
Fzd1	A	T	5: 4,756,385	I399K	probably damaging	Het
Gdi2	T	A	13: 3,564,547	Y333*	probably null	Het
Gm10479	A	G	12: 20,433,653	H91R	probably benign	Het
Gm10842	G	A	11: 105,147,041	R50K	unknown	Het
Grin2c	A	T	11: 115,260,732		probably null	Het
Grk2	C	T	19: 4,294,883	V53M	probably damaging	Het
H2-M10.2	C	T	17: 36,285,871	M104I	probably benign	Het
Hyou1	C	T	9: 44,384,182	Q290*	probably null	Het
Itgb2	T	C	10: 77,564,790	S746P	probably benign	Het
Jmjd7	C	T	2: 120,030,108	L39F	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Klhl2	T	C	8: 64,759,797	E236G	probably damaging	Het
Krtap19-4	C	A	16: 88,884,991	G26C	unknown	Het
Krtap4-16	G	A	11: 99,851,172	T134I	possibly damaging	Het
Lamb2	A	G	9: 108,488,099	H1318R	probably benign	Het
Mab21l3	G	A	3: 101,835,130	T38M	probably benign	Het
Mfsd10	A	T	5: 34,636,750	D6E	possibly damaging	Het
Mnat1	G	T	12: 73,179,233	G91*	probably null	Het
Mns1	A	T	9: 72,452,734	I389F	probably damaging	Het
Morc1	A	T	16: 48,622,638	T829S	probably benign	Het
Morn5	T	A	2: 36,053,077	V63E	probably benign	Het
Mybpc1	T	C	10: 88,553,295	T404A	possibly damaging	Het
Npc1l1	A	T	11: 6,228,846	M188K	probably damaging	Het
Nrcam	T	A	12: 44,572,208	M846K	probably benign	Het
Nup210	A	C	6: 91,074,282	F373C	probably damaging	Het
Olfr1299	G	T	2: 111,664,754	S176I	probably damaging	Het
Olfr1465	A	T	19: 13,314,171	V38E	possibly damaging	Het
Olfr830	T	C	9: 18,876,080	V248A	probably damaging	Het
Osbpl8	T	C	10: 111,275,049	S471P	probably damaging	Het
Plekhn1	A	T	4: 156,222,381	I517N	probably benign	Het
Plin4	G	T	17: 56,104,931	T700K	probably damaging	Het
Plxna4	A	T	6: 32,517,444	V79D	probably damaging	Het
Prdm16	A	T	4: 154,335,261	M897K	probably damaging	Het
Ptprg	T	A	14: 12,091,410		probably null	Het
Rcan2	G	T	17: 44,037,033	C211F	probably damaging	Het
Scn2a	G	A	2: 65,670,767		probably null	Het
Scnn1a	A	C	6: 125,332,194	R264S	probably damaging	Het
Sema4g	T	C	19: 44,998,020	V345A	probably benign	Het
Sgo2b	T	A	8: 63,927,392	D802V	probably benign	Het
Slc25a21	G	A	12: 56,858,087	T54I	probably benign	Het
Slc25a46	C	T	18: 31,594,588	E223K	probably damaging	Het
Slc25a54	A	G	3: 109,102,697	I171V	probably benign	Het
Slc7a6	T	C	8: 106,192,456	V224A	possibly damaging	Het
Smchd1	A	T	17: 71,387,006	V1248E	probably damaging	Het
Sort1	C	A	3: 108,325,699	F196L	probably damaging	Het
Sptbn4	G	A	7: 27,418,583	T357M	probably damaging	Het
Srrm3	T	A	5: 135,857,129	W308R	probably damaging	Het
Stard9	A	T	2: 120,701,489	E2742D	probably benign	Het
Tas1r1	T	A	4: 152,032,248	I310F	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tff1	A	T	17: 31,161,586	C85*	probably null	Het
Tlr11	C	T	14: 50,360,647	T30I	probably benign	Het
Trio	T	C	15: 27,748,340	T1265A	probably benign	Het
Ttc7b	T	C	12: 100,407,002	M338V	possibly damaging	Het
Umod	T	A	7: 119,464,724	S620C	probably damaging	Het
Ust	C	A	10: 8,298,055		probably null	Het
Vmn1r176	A	T	7: 23,835,184	S181R	probably damaging	Het
Vmn1r202	T	C	13: 22,502,143	T35A	probably benign	Het
Vmn1r39	C	A	6: 66,804,911	R104L	probably benign	Het
Vps13b	T	A	15: 35,430,205	Y286*	probably null	Het
Zfp579	G	A	7: 4,993,770	R381C	probably damaging	Het
Zfp85	A	G	13: 67,751,628	S71P	probably benign	Het
Zfyve16	A	T	13: 92,504,085	V1254E	probably damaging	Het

Other mutations in Rxfp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01758:Rxfp1	APN	3	79652216	missense	possibly damaging	0.81
IGL01962:Rxfp1	APN	3	79686868	missense	probably damaging	1.00
IGL01975:Rxfp1	APN	3	79660078	missense	possibly damaging	0.95
IGL01998:Rxfp1	APN	3	79660096	missense	probably benign	0.01
IGL02049:Rxfp1	APN	3	79650492	missense	probably damaging	0.99
IGL02153:Rxfp1	APN	3	79660120	missense	probably benign	0.00
IGL02490:Rxfp1	APN	3	79652167	critical splice donor site	probably null
IGL02526:Rxfp1	APN	3	79670846	critical splice donor site	probably null
IGL02985:Rxfp1	APN	3	79652226	missense	possibly damaging	0.65
IGL03252:Rxfp1	APN	3	79667683	missense	probably benign	0.29
juggler	UTSW	3	79650591	nonsense	probably null
R0123:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0134:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0230:Rxfp1	UTSW	3	79644975	missense	probably damaging	1.00
R0257:Rxfp1	UTSW	3	79682535	missense	possibly damaging	0.61
R0265:Rxfp1	UTSW	3	79667654	missense	probably benign	0.00
R0362:Rxfp1	UTSW	3	79737793	start codon destroyed	probably null	0.99
R0394:Rxfp1	UTSW	3	79652377	missense	possibly damaging	0.58
R0422:Rxfp1	UTSW	3	79650731	missense	probably benign	0.00
R0547:Rxfp1	UTSW	3	79705569	splice site	probably null
R0627:Rxfp1	UTSW	3	79648211	missense	probably benign	0.00
R0671:Rxfp1	UTSW	3	79663293	splice site	probably null
R1309:Rxfp1	UTSW	3	79663292	splice site	probably null
R1756:Rxfp1	UTSW	3	79670881	missense	probably benign	0.11
R2415:Rxfp1	UTSW	3	79663319	missense	probably benign	0.14
R2862:Rxfp1	UTSW	3	79682471	missense	possibly damaging	0.80
R4087:Rxfp1	UTSW	3	79644949	missense	probably damaging	0.99
R4091:Rxfp1	UTSW	3	79644761	missense	probably benign
R4250:Rxfp1	UTSW	3	79652272	missense	probably benign	0.41
R4335:Rxfp1	UTSW	3	79686798	critical splice donor site	probably null
R4447:Rxfp1	UTSW	3	79652127	intron	probably benign
R4607:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4608:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4676:Rxfp1	UTSW	3	79705668	missense	probably damaging	1.00
R4768:Rxfp1	UTSW	3	79686868	missense	probably damaging	1.00
R4812:Rxfp1	UTSW	3	79650582	missense	probably benign	0.00
R4909:Rxfp1	UTSW	3	79644802	missense	probably benign
R5059:Rxfp1	UTSW	3	79663312	missense	probably benign
R5131:Rxfp1	UTSW	3	79652164	splice site	probably null
R5641:Rxfp1	UTSW	3	79686892	missense	probably damaging	0.98
R5711:Rxfp1	UTSW	3	79678747	missense	probably damaging	1.00
R5757:Rxfp1	UTSW	3	79661320	missense	possibly damaging	0.89
R5856:Rxfp1	UTSW	3	79663313	missense	possibly damaging	0.76
R6296:Rxfp1	UTSW	3	79667848	missense	probably damaging	1.00
R6462:Rxfp1	UTSW	3	79648289	missense	probably benign	0.07
R6730:Rxfp1	UTSW	3	79650591	nonsense	probably null
R7059:Rxfp1	UTSW	3	79652269	missense	probably damaging	1.00
R7530:Rxfp1	UTSW	3	79650461	missense	probably benign	0.18
R7626:Rxfp1	UTSW	3	79648090	missense	probably damaging	0.99
R7684:Rxfp1	UTSW	3	79670907	missense	possibly damaging	0.66
R7951:Rxfp1	UTSW	3	79652375	missense	probably damaging	1.00
Z1088:Rxfp1	UTSW	3	79705704	missense	probably damaging	1.00
Z1177:Rxfp1	UTSW	3	79652367	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CGGGCATAGTCTTTGCACAG -3'
(R):5'- TGTGAAGGCTTTGTCAGAGC -3'

Sequencing Primer
(F):5'- GGGCATAGTCTTTGCACAGAACTTAC -3'
(R):5'- GTAAACAGAGCCTATGTGCTCTCAG -3'

Posted On

2014-06-23