Incidental Mutation 'R1803:Dpy19l4'
ID203265
Institutional Source Beutler Lab
Gene Symbol Dpy19l4
Ensembl Gene ENSMUSG00000045205
Gene Namedpy-19-like 4 (C. elegans)
SynonymsNarg3, LOC381510
MMRRC Submission 039833-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1803 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location11261315-11322137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11281020 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 475 (V475E)
Ref Sequence ENSEMBL: ENSMUSP00000122823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084892] [ENSMUST00000128024] [ENSMUST00000139385] [ENSMUST00000142005]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084892
AA Change: V519E

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081954
Gene: ENSMUSG00000045205
AA Change: V519E

DomainStartEndE-ValueType
Pfam:Dpy19 59 714 3e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128024
AA Change: V475E

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122823
Gene: ENSMUSG00000045205
AA Change: V475E

DomainStartEndE-ValueType
Pfam:Dpy19 58 293 1e-89 PFAM
Pfam:Dpy19 291 524 4.8e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139385
AA Change: V293E

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115537
Gene: ENSMUSG00000045205
AA Change: V293E

DomainStartEndE-ValueType
Pfam:Dpy19 1 258 3.2e-71 PFAM
Pfam:Dpy19 254 488 7e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142005
SMART Domains Protein: ENSMUSP00000119923
Gene: ENSMUSG00000045205

DomainStartEndE-ValueType
Pfam:Dpy19 58 253 6.9e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158560
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A T 17: 79,627,666 probably benign Het
9330182L06Rik A G 5: 9,427,832 H410R probably benign Het
Adgrl3 C T 5: 81,771,617 R586* probably null Het
Arpp21 T C 9: 112,127,398 T471A possibly damaging Het
Blnk T C 19: 40,952,377 E194G probably damaging Het
Cd44 G A 2: 102,834,252 P332S probably damaging Het
Cd47 T C 16: 49,867,806 F30L possibly damaging Het
Cdh23 T C 10: 60,331,281 E1861G probably damaging Het
Cdkal1 T A 13: 29,517,471 M332L probably damaging Het
Cul9 A G 17: 46,503,097 S2284P probably damaging Het
Cyp2a5 G T 7: 26,835,546 probably null Het
Dcp2 T C 18: 44,395,917 I33T probably damaging Het
Ddx52 A T 11: 83,946,132 I150L probably damaging Het
Ddx58 A G 4: 40,224,013 S289P probably benign Het
Dennd5a T A 7: 109,898,613 T1067S probably benign Het
Dnpep A T 1: 75,309,414 L419* probably null Het
Dock8 A G 19: 25,132,235 K927R probably benign Het
Edf1 C T 2: 25,560,194 S41F probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha3 T C 16: 63,602,288 K579E probably benign Het
Exoc1 A G 5: 76,561,441 N23S probably benign Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Flt3 C A 5: 147,367,055 E358* probably null Het
Fzd1 A T 5: 4,756,385 I399K probably damaging Het
Gdi2 T A 13: 3,564,547 Y333* probably null Het
Gm10479 A G 12: 20,433,653 H91R probably benign Het
Gm10842 G A 11: 105,147,041 R50K unknown Het
Grin2c A T 11: 115,260,732 probably null Het
Grk2 C T 19: 4,294,883 V53M probably damaging Het
H2-M10.2 C T 17: 36,285,871 M104I probably benign Het
Hyou1 C T 9: 44,384,182 Q290* probably null Het
Itgb2 T C 10: 77,564,790 S746P probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl2 T C 8: 64,759,797 E236G probably damaging Het
Krtap19-4 C A 16: 88,884,991 G26C unknown Het
Krtap4-16 G A 11: 99,851,172 T134I possibly damaging Het
Lamb2 A G 9: 108,488,099 H1318R probably benign Het
Mab21l3 G A 3: 101,835,130 T38M probably benign Het
Mfsd10 A T 5: 34,636,750 D6E possibly damaging Het
Mnat1 G T 12: 73,179,233 G91* probably null Het
Mns1 A T 9: 72,452,734 I389F probably damaging Het
Morc1 A T 16: 48,622,638 T829S probably benign Het
Morn5 T A 2: 36,053,077 V63E probably benign Het
Mybpc1 T C 10: 88,553,295 T404A possibly damaging Het
Npc1l1 A T 11: 6,228,846 M188K probably damaging Het
Nrcam T A 12: 44,572,208 M846K probably benign Het
Nup210 A C 6: 91,074,282 F373C probably damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1465 A T 19: 13,314,171 V38E possibly damaging Het
Olfr830 T C 9: 18,876,080 V248A probably damaging Het
Osbpl8 T C 10: 111,275,049 S471P probably damaging Het
Plekhn1 A T 4: 156,222,381 I517N probably benign Het
Plin4 G T 17: 56,104,931 T700K probably damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Prdm16 A T 4: 154,335,261 M897K probably damaging Het
Ptprg T A 14: 12,091,410 probably null Het
Rcan2 G T 17: 44,037,033 C211F probably damaging Het
Rxfp1 C T 3: 79,737,769 C9Y probably benign Het
Scn2a G A 2: 65,670,767 probably null Het
Scnn1a A C 6: 125,332,194 R264S probably damaging Het
Sema4g T C 19: 44,998,020 V345A probably benign Het
Sgo2b T A 8: 63,927,392 D802V probably benign Het
Slc25a21 G A 12: 56,858,087 T54I probably benign Het
Slc25a46 C T 18: 31,594,588 E223K probably damaging Het
Slc25a54 A G 3: 109,102,697 I171V probably benign Het
Slc7a6 T C 8: 106,192,456 V224A possibly damaging Het
Smchd1 A T 17: 71,387,006 V1248E probably damaging Het
Sort1 C A 3: 108,325,699 F196L probably damaging Het
Sptbn4 G A 7: 27,418,583 T357M probably damaging Het
Srrm3 T A 5: 135,857,129 W308R probably damaging Het
Stard9 A T 2: 120,701,489 E2742D probably benign Het
Tas1r1 T A 4: 152,032,248 I310F probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tff1 A T 17: 31,161,586 C85* probably null Het
Tlr11 C T 14: 50,360,647 T30I probably benign Het
Trio T C 15: 27,748,340 T1265A probably benign Het
Ttc7b T C 12: 100,407,002 M338V possibly damaging Het
Umod T A 7: 119,464,724 S620C probably damaging Het
Ust C A 10: 8,298,055 probably null Het
Vmn1r176 A T 7: 23,835,184 S181R probably damaging Het
Vmn1r202 T C 13: 22,502,143 T35A probably benign Het
Vmn1r39 C A 6: 66,804,911 R104L probably benign Het
Vps13b T A 15: 35,430,205 Y286* probably null Het
Zfp579 G A 7: 4,993,770 R381C probably damaging Het
Zfp85 A G 13: 67,751,628 S71P probably benign Het
Zfyve16 A T 13: 92,504,085 V1254E probably damaging Het
Other mutations in Dpy19l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dpy19l4 APN 4 11290411 missense probably benign 0.00
IGL01402:Dpy19l4 APN 4 11273006 critical splice donor site probably null
IGL01404:Dpy19l4 APN 4 11273006 critical splice donor site probably null
IGL01643:Dpy19l4 APN 4 11290184 splice site probably benign
IGL01758:Dpy19l4 APN 4 11265846 missense probably damaging 1.00
IGL01896:Dpy19l4 APN 4 11267752 missense possibly damaging 0.81
IGL02222:Dpy19l4 APN 4 11281116 missense possibly damaging 0.93
IGL02314:Dpy19l4 APN 4 11267720 missense possibly damaging 0.50
IGL02422:Dpy19l4 APN 4 11265803 missense possibly damaging 0.95
IGL02565:Dpy19l4 APN 4 11309440 missense probably benign 0.14
IGL03121:Dpy19l4 APN 4 11303334 missense probably damaging 1.00
IGL03357:Dpy19l4 APN 4 11267615 missense probably damaging 1.00
IGL03368:Dpy19l4 APN 4 11290253 missense possibly damaging 0.53
R0003:Dpy19l4 UTSW 4 11267619 missense probably damaging 1.00
R0481:Dpy19l4 UTSW 4 11272993 splice site probably benign
R0506:Dpy19l4 UTSW 4 11289715 missense probably benign 0.07
R1114:Dpy19l4 UTSW 4 11287643 splice site probably benign
R1332:Dpy19l4 UTSW 4 11276901 missense probably damaging 1.00
R1336:Dpy19l4 UTSW 4 11276901 missense probably damaging 1.00
R1355:Dpy19l4 UTSW 4 11303371 nonsense probably null
R1421:Dpy19l4 UTSW 4 11304011 missense probably benign 0.09
R1422:Dpy19l4 UTSW 4 11317168 missense possibly damaging 0.88
R1465:Dpy19l4 UTSW 4 11296034 missense probably damaging 1.00
R1465:Dpy19l4 UTSW 4 11296034 missense probably damaging 1.00
R1766:Dpy19l4 UTSW 4 11303360 missense probably damaging 1.00
R2090:Dpy19l4 UTSW 4 11304344 missense probably benign 0.34
R2324:Dpy19l4 UTSW 4 11276857 unclassified probably benign
R2446:Dpy19l4 UTSW 4 11304143 splice site probably null
R3769:Dpy19l4 UTSW 4 11276868 splice site probably null
R4151:Dpy19l4 UTSW 4 11309485 missense possibly damaging 0.89
R4472:Dpy19l4 UTSW 4 11304053 missense possibly damaging 0.91
R4609:Dpy19l4 UTSW 4 11295999 nonsense probably null
R4708:Dpy19l4 UTSW 4 11277970 missense probably benign 0.00
R4722:Dpy19l4 UTSW 4 11290521 missense possibly damaging 0.84
R4997:Dpy19l4 UTSW 4 11287493 missense probably benign 0.01
R5085:Dpy19l4 UTSW 4 11265943 critical splice acceptor site probably null
R5088:Dpy19l4 UTSW 4 11303357 missense probably damaging 1.00
R5288:Dpy19l4 UTSW 4 11289721 missense probably damaging 1.00
R5288:Dpy19l4 UTSW 4 11304014 missense probably damaging 1.00
R5413:Dpy19l4 UTSW 4 11289700 missense probably damaging 1.00
R5758:Dpy19l4 UTSW 4 11276886 missense probably damaging 1.00
R6024:Dpy19l4 UTSW 4 11276876 missense probably damaging 1.00
R6312:Dpy19l4 UTSW 4 11289671 nonsense probably null
R6339:Dpy19l4 UTSW 4 11285111 missense probably damaging 0.98
R7055:Dpy19l4 UTSW 4 11290291 critical splice acceptor site probably null
R7359:Dpy19l4 UTSW 4 11273125 missense probably benign 0.00
R7525:Dpy19l4 UTSW 4 11317160 nonsense probably null
R7579:Dpy19l4 UTSW 4 11265909 missense probably benign 0.39
R7913:Dpy19l4 UTSW 4 11265859 nonsense probably null
R8047:Dpy19l4 UTSW 4 11317139 missense probably benign 0.00
R8049:Dpy19l4 UTSW 4 11303982 missense probably benign 0.44
R8495:Dpy19l4 UTSW 4 11267659 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTGCAACAAGAACGAG -3'
(R):5'- GGGTACTAATCTGTTGCTGAAAAC -3'

Sequencing Primer
(F):5'- GAACTCACTTTGTAGACCAGGCTG -3'
(R):5'- TCTGTTGCTGAAAACTAGAAGTG -3'
Posted On2014-06-23