Incidental Mutation 'R1803:Olfr830'
ID203296
Institutional Source Beutler Lab
Gene Symbol Olfr830
Ensembl Gene ENSMUSG00000062868
Gene Nameolfactory receptor 830
SynonymsGA_x6K02T2PVTD-12618399-12619337, MOR152-1
MMRRC Submission 039833-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1803 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location18874693-18878369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18876080 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 248 (V248A)
Ref Sequence ENSEMBL: ENSMUSP00000148394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078861] [ENSMUST00000212723]
Predicted Effect probably damaging
Transcript: ENSMUST00000078861
AA Change: V251A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077903
Gene: ENSMUSG00000062868
AA Change: V251A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7tm_1 44 293 1.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212723
AA Change: V248A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A T 17: 79,627,666 probably benign Het
9330182L06Rik A G 5: 9,427,832 H410R probably benign Het
Adgrl3 C T 5: 81,771,617 R586* probably null Het
Arpp21 T C 9: 112,127,398 T471A possibly damaging Het
Blnk T C 19: 40,952,377 E194G probably damaging Het
Cd44 G A 2: 102,834,252 P332S probably damaging Het
Cd47 T C 16: 49,867,806 F30L possibly damaging Het
Cdh23 T C 10: 60,331,281 E1861G probably damaging Het
Cdkal1 T A 13: 29,517,471 M332L probably damaging Het
Cul9 A G 17: 46,503,097 S2284P probably damaging Het
Cyp2a5 G T 7: 26,835,546 probably null Het
Dcp2 T C 18: 44,395,917 I33T probably damaging Het
Ddx52 A T 11: 83,946,132 I150L probably damaging Het
Ddx58 A G 4: 40,224,013 S289P probably benign Het
Dennd5a T A 7: 109,898,613 T1067S probably benign Het
Dnpep A T 1: 75,309,414 L419* probably null Het
Dock8 A G 19: 25,132,235 K927R probably benign Het
Dpy19l4 A T 4: 11,281,020 V475E possibly damaging Het
Edf1 C T 2: 25,560,194 S41F probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha3 T C 16: 63,602,288 K579E probably benign Het
Exoc1 A G 5: 76,561,441 N23S probably benign Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Flt3 C A 5: 147,367,055 E358* probably null Het
Fzd1 A T 5: 4,756,385 I399K probably damaging Het
Gdi2 T A 13: 3,564,547 Y333* probably null Het
Gm10479 A G 12: 20,433,653 H91R probably benign Het
Gm10842 G A 11: 105,147,041 R50K unknown Het
Grin2c A T 11: 115,260,732 probably null Het
Grk2 C T 19: 4,294,883 V53M probably damaging Het
H2-M10.2 C T 17: 36,285,871 M104I probably benign Het
Hyou1 C T 9: 44,384,182 Q290* probably null Het
Itgb2 T C 10: 77,564,790 S746P probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl2 T C 8: 64,759,797 E236G probably damaging Het
Krtap19-4 C A 16: 88,884,991 G26C unknown Het
Krtap4-16 G A 11: 99,851,172 T134I possibly damaging Het
Lamb2 A G 9: 108,488,099 H1318R probably benign Het
Mab21l3 G A 3: 101,835,130 T38M probably benign Het
Mfsd10 A T 5: 34,636,750 D6E possibly damaging Het
Mnat1 G T 12: 73,179,233 G91* probably null Het
Mns1 A T 9: 72,452,734 I389F probably damaging Het
Morc1 A T 16: 48,622,638 T829S probably benign Het
Morn5 T A 2: 36,053,077 V63E probably benign Het
Mybpc1 T C 10: 88,553,295 T404A possibly damaging Het
Npc1l1 A T 11: 6,228,846 M188K probably damaging Het
Nrcam T A 12: 44,572,208 M846K probably benign Het
Nup210 A C 6: 91,074,282 F373C probably damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1465 A T 19: 13,314,171 V38E possibly damaging Het
Osbpl8 T C 10: 111,275,049 S471P probably damaging Het
Plekhn1 A T 4: 156,222,381 I517N probably benign Het
Plin4 G T 17: 56,104,931 T700K probably damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Prdm16 A T 4: 154,335,261 M897K probably damaging Het
Ptprg T A 14: 12,091,410 probably null Het
Rcan2 G T 17: 44,037,033 C211F probably damaging Het
Rxfp1 C T 3: 79,737,769 C9Y probably benign Het
Scn2a G A 2: 65,670,767 probably null Het
Scnn1a A C 6: 125,332,194 R264S probably damaging Het
Sema4g T C 19: 44,998,020 V345A probably benign Het
Sgo2b T A 8: 63,927,392 D802V probably benign Het
Slc25a21 G A 12: 56,858,087 T54I probably benign Het
Slc25a46 C T 18: 31,594,588 E223K probably damaging Het
Slc25a54 A G 3: 109,102,697 I171V probably benign Het
Slc7a6 T C 8: 106,192,456 V224A possibly damaging Het
Smchd1 A T 17: 71,387,006 V1248E probably damaging Het
Sort1 C A 3: 108,325,699 F196L probably damaging Het
Sptbn4 G A 7: 27,418,583 T357M probably damaging Het
Srrm3 T A 5: 135,857,129 W308R probably damaging Het
Stard9 A T 2: 120,701,489 E2742D probably benign Het
Tas1r1 T A 4: 152,032,248 I310F probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tff1 A T 17: 31,161,586 C85* probably null Het
Tlr11 C T 14: 50,360,647 T30I probably benign Het
Trio T C 15: 27,748,340 T1265A probably benign Het
Ttc7b T C 12: 100,407,002 M338V possibly damaging Het
Umod T A 7: 119,464,724 S620C probably damaging Het
Ust C A 10: 8,298,055 probably null Het
Vmn1r176 A T 7: 23,835,184 S181R probably damaging Het
Vmn1r202 T C 13: 22,502,143 T35A probably benign Het
Vmn1r39 C A 6: 66,804,911 R104L probably benign Het
Vps13b T A 15: 35,430,205 Y286* probably null Het
Zfp579 G A 7: 4,993,770 R381C probably damaging Het
Zfp85 A G 13: 67,751,628 S71P probably benign Het
Zfyve16 A T 13: 92,504,085 V1254E probably damaging Het
Other mutations in Olfr830
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Olfr830 APN 9 18876014 nonsense probably null
IGL00954:Olfr830 APN 9 18876073 missense probably benign 0.15
IGL01090:Olfr830 APN 9 18876242 missense probably benign 0.00
IGL01613:Olfr830 APN 9 18875321 splice site probably benign
IGL01987:Olfr830 APN 9 18875707 missense probably benign 0.00
IGL03018:Olfr830 APN 9 18876227 missense probably benign 0.15
IGL03037:Olfr830 APN 9 18875372 missense probably damaging 0.98
R0284:Olfr830 UTSW 9 18875552 missense probably benign
R1322:Olfr830 UTSW 9 18875521 missense possibly damaging 0.90
R1715:Olfr830 UTSW 9 18875794 missense probably benign 0.06
R4360:Olfr830 UTSW 9 18875717 missense probably damaging 1.00
R4394:Olfr830 UTSW 9 18875611 missense probably damaging 0.98
R4642:Olfr830 UTSW 9 18876167 missense probably damaging 1.00
R4796:Olfr830 UTSW 9 18876179 missense probably damaging 0.96
R4814:Olfr830 UTSW 9 18875917 missense probably benign 0.30
R5210:Olfr830 UTSW 9 18875807 missense probably damaging 1.00
R5375:Olfr830 UTSW 9 18876146 missense probably benign 0.08
R6072:Olfr830 UTSW 9 18875422 missense probably benign
R6361:Olfr830 UTSW 9 18875731 missense probably damaging 1.00
R6602:Olfr830 UTSW 9 18875849 missense possibly damaging 0.81
R6920:Olfr830 UTSW 9 18875525 missense probably damaging 1.00
R7730:Olfr830 UTSW 9 18875413 missense probably benign 0.00
R7780:Olfr830 UTSW 9 18875614 missense possibly damaging 0.65
R8245:Olfr830 UTSW 9 18875830 missense probably benign
R8274:Olfr830 UTSW 9 18875499 missense probably benign 0.36
X0026:Olfr830 UTSW 9 18875635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACAGACCTGGAAATCCTC -3'
(R):5'- ACCAATAACTTTCTTCAGGGCC -3'

Sequencing Primer
(F):5'- TTGCACAAATCCTGAAGCTTGC -3'
(R):5'- AGGGCCTCCTTCATATCCCTG -3'
Posted On2014-06-23