Incidental Mutation 'R1803:Grin2c'
ID203312
Institutional Source Beutler Lab
Gene Symbol Grin2c
Ensembl Gene ENSMUSG00000020734
Gene Nameglutamate receptor, ionotropic, NMDA2C (epsilon 3)
SynonymsNR2C, GluRepsilon3, NMDAR2C
MMRRC Submission 039833-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R1803 (G1)
Quality Score190
Status Not validated
Chromosome11
Chromosomal Location115249169-115267243 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 115260732 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003351] [ENSMUST00000106554]
Predicted Effect probably null
Transcript: ENSMUST00000003351
SMART Domains Protein: ENSMUSP00000003351
Gene: ENSMUSG00000020734

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 99 299 5.1e-12 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 924 6.8e-15 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106554
SMART Domains Protein: ENSMUSP00000102164
Gene: ENSMUSG00000020734

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 100 306 6.9e-10 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 926 1.1e-13 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deficits in motor coordination and reduced granule cell responses to N-methy-D-aspartate in brain slices. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A T 17: 79,627,666 probably benign Het
9330182L06Rik A G 5: 9,427,832 H410R probably benign Het
Adgrl3 C T 5: 81,771,617 R586* probably null Het
Arpp21 T C 9: 112,127,398 T471A possibly damaging Het
Blnk T C 19: 40,952,377 E194G probably damaging Het
Cd44 G A 2: 102,834,252 P332S probably damaging Het
Cd47 T C 16: 49,867,806 F30L possibly damaging Het
Cdh23 T C 10: 60,331,281 E1861G probably damaging Het
Cdkal1 T A 13: 29,517,471 M332L probably damaging Het
Cul9 A G 17: 46,503,097 S2284P probably damaging Het
Cyp2a5 G T 7: 26,835,546 probably null Het
Dcp2 T C 18: 44,395,917 I33T probably damaging Het
Ddx52 A T 11: 83,946,132 I150L probably damaging Het
Ddx58 A G 4: 40,224,013 S289P probably benign Het
Dennd5a T A 7: 109,898,613 T1067S probably benign Het
Dnpep A T 1: 75,309,414 L419* probably null Het
Dock8 A G 19: 25,132,235 K927R probably benign Het
Dpy19l4 A T 4: 11,281,020 V475E possibly damaging Het
Edf1 C T 2: 25,560,194 S41F probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha3 T C 16: 63,602,288 K579E probably benign Het
Exoc1 A G 5: 76,561,441 N23S probably benign Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Flt3 C A 5: 147,367,055 E358* probably null Het
Fzd1 A T 5: 4,756,385 I399K probably damaging Het
Gdi2 T A 13: 3,564,547 Y333* probably null Het
Gm10479 A G 12: 20,433,653 H91R probably benign Het
Gm10842 G A 11: 105,147,041 R50K unknown Het
Grk2 C T 19: 4,294,883 V53M probably damaging Het
H2-M10.2 C T 17: 36,285,871 M104I probably benign Het
Hyou1 C T 9: 44,384,182 Q290* probably null Het
Itgb2 T C 10: 77,564,790 S746P probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl2 T C 8: 64,759,797 E236G probably damaging Het
Krtap19-4 C A 16: 88,884,991 G26C unknown Het
Krtap4-16 G A 11: 99,851,172 T134I possibly damaging Het
Lamb2 A G 9: 108,488,099 H1318R probably benign Het
Mab21l3 G A 3: 101,835,130 T38M probably benign Het
Mfsd10 A T 5: 34,636,750 D6E possibly damaging Het
Mnat1 G T 12: 73,179,233 G91* probably null Het
Mns1 A T 9: 72,452,734 I389F probably damaging Het
Morc1 A T 16: 48,622,638 T829S probably benign Het
Morn5 T A 2: 36,053,077 V63E probably benign Het
Mybpc1 T C 10: 88,553,295 T404A possibly damaging Het
Npc1l1 A T 11: 6,228,846 M188K probably damaging Het
Nrcam T A 12: 44,572,208 M846K probably benign Het
Nup210 A C 6: 91,074,282 F373C probably damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1465 A T 19: 13,314,171 V38E possibly damaging Het
Olfr830 T C 9: 18,876,080 V248A probably damaging Het
Osbpl8 T C 10: 111,275,049 S471P probably damaging Het
Plekhn1 A T 4: 156,222,381 I517N probably benign Het
Plin4 G T 17: 56,104,931 T700K probably damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Prdm16 A T 4: 154,335,261 M897K probably damaging Het
Ptprg T A 14: 12,091,410 probably null Het
Rcan2 G T 17: 44,037,033 C211F probably damaging Het
Rxfp1 C T 3: 79,737,769 C9Y probably benign Het
Scn2a G A 2: 65,670,767 probably null Het
Scnn1a A C 6: 125,332,194 R264S probably damaging Het
Sema4g T C 19: 44,998,020 V345A probably benign Het
Sgo2b T A 8: 63,927,392 D802V probably benign Het
Slc25a21 G A 12: 56,858,087 T54I probably benign Het
Slc25a46 C T 18: 31,594,588 E223K probably damaging Het
Slc25a54 A G 3: 109,102,697 I171V probably benign Het
Slc7a6 T C 8: 106,192,456 V224A possibly damaging Het
Smchd1 A T 17: 71,387,006 V1248E probably damaging Het
Sort1 C A 3: 108,325,699 F196L probably damaging Het
Sptbn4 G A 7: 27,418,583 T357M probably damaging Het
Srrm3 T A 5: 135,857,129 W308R probably damaging Het
Stard9 A T 2: 120,701,489 E2742D probably benign Het
Tas1r1 T A 4: 152,032,248 I310F probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tff1 A T 17: 31,161,586 C85* probably null Het
Tlr11 C T 14: 50,360,647 T30I probably benign Het
Trio T C 15: 27,748,340 T1265A probably benign Het
Ttc7b T C 12: 100,407,002 M338V possibly damaging Het
Umod T A 7: 119,464,724 S620C probably damaging Het
Ust C A 10: 8,298,055 probably null Het
Vmn1r176 A T 7: 23,835,184 S181R probably damaging Het
Vmn1r202 T C 13: 22,502,143 T35A probably benign Het
Vmn1r39 C A 6: 66,804,911 R104L probably benign Het
Vps13b T A 15: 35,430,205 Y286* probably null Het
Zfp579 G A 7: 4,993,770 R381C probably damaging Het
Zfp85 A G 13: 67,751,628 S71P probably benign Het
Zfyve16 A T 13: 92,504,085 V1254E probably damaging Het
Other mutations in Grin2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Grin2c APN 11 115258110 missense possibly damaging 0.94
IGL01306:Grin2c APN 11 115256194 missense probably benign 0.01
IGL01408:Grin2c APN 11 115260882 missense probably damaging 1.00
IGL01539:Grin2c APN 11 115250106 missense probably benign 0.32
IGL01931:Grin2c APN 11 115253910 missense probably damaging 1.00
IGL01964:Grin2c APN 11 115253847 missense probably damaging 1.00
IGL02796:Grin2c APN 11 115250717 splice site probably benign
IGL02956:Grin2c APN 11 115257959 missense possibly damaging 0.86
IGL03221:Grin2c APN 11 115254044 splice site probably benign
ANU23:Grin2c UTSW 11 115256194 missense probably benign 0.01
BB007:Grin2c UTSW 11 115256237 missense probably benign 0.01
BB017:Grin2c UTSW 11 115256237 missense probably benign 0.01
PIT4362001:Grin2c UTSW 11 115249633 missense probably benign
R0011:Grin2c UTSW 11 115255750 missense probably damaging 1.00
R0011:Grin2c UTSW 11 115255750 missense probably damaging 1.00
R0112:Grin2c UTSW 11 115251134 missense probably damaging 1.00
R0355:Grin2c UTSW 11 115260728 splice site probably benign
R0681:Grin2c UTSW 11 115249653 missense probably benign
R0791:Grin2c UTSW 11 115250646 missense probably damaging 1.00
R0792:Grin2c UTSW 11 115250646 missense probably damaging 1.00
R1512:Grin2c UTSW 11 115253850 missense probably damaging 1.00
R1572:Grin2c UTSW 11 115256074 missense possibly damaging 0.92
R1654:Grin2c UTSW 11 115260853 missense probably benign 0.21
R1982:Grin2c UTSW 11 115260905 missense possibly damaging 0.96
R2050:Grin2c UTSW 11 115257419 missense possibly damaging 0.89
R2196:Grin2c UTSW 11 115250666 missense probably benign 0.34
R2442:Grin2c UTSW 11 115251134 missense probably damaging 1.00
R2509:Grin2c UTSW 11 115251068 nonsense probably null
R3440:Grin2c UTSW 11 115250643 missense probably damaging 1.00
R3965:Grin2c UTSW 11 115260994 missense probably damaging 1.00
R4618:Grin2c UTSW 11 115252747 missense probably damaging 1.00
R4735:Grin2c UTSW 11 115249596 missense possibly damaging 0.63
R4856:Grin2c UTSW 11 115260790 missense probably damaging 1.00
R4886:Grin2c UTSW 11 115260790 missense probably damaging 1.00
R5277:Grin2c UTSW 11 115253813 missense probably damaging 1.00
R5334:Grin2c UTSW 11 115256055 missense possibly damaging 0.76
R5553:Grin2c UTSW 11 115252725 missense probably null 0.96
R5711:Grin2c UTSW 11 115250289 missense probably benign 0.32
R5784:Grin2c UTSW 11 115258295 missense possibly damaging 0.94
R5849:Grin2c UTSW 11 115260991 missense probably benign
R6421:Grin2c UTSW 11 115251130 missense probably damaging 1.00
R6461:Grin2c UTSW 11 115255696 missense possibly damaging 0.96
R6658:Grin2c UTSW 11 115258282 missense possibly damaging 0.64
R7205:Grin2c UTSW 11 115251050 missense probably damaging 0.99
R7611:Grin2c UTSW 11 115252685 missense probably damaging 1.00
R7637:Grin2c UTSW 11 115256259 splice site probably null
R7751:Grin2c UTSW 11 115253870 missense probably damaging 1.00
R7847:Grin2c UTSW 11 115260978 missense possibly damaging 0.68
R7920:Grin2c UTSW 11 115254144 missense probably benign 0.33
R7930:Grin2c UTSW 11 115256237 missense probably benign 0.01
R7940:Grin2c UTSW 11 115255281 missense probably damaging 1.00
R7956:Grin2c UTSW 11 115250148 missense probably benign 0.16
R8081:Grin2c UTSW 11 115249893 missense probably damaging 0.98
R8249:Grin2c UTSW 11 115253837 missense probably damaging 0.98
R8447:Grin2c UTSW 11 115257389 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGATACTGAGGAGCCAGG -3'
(R):5'- TGGACTTGCCTCTGGAGATC -3'

Sequencing Primer
(F):5'- AGGAGCCAGGGAACATCCTC -3'
(R):5'- TGGAGATCCAGCCACTCAC -3'
Posted On2014-06-23