Incidental Mutation 'R1803:Slc25a21'
ID203315
Institutional Source Beutler Lab
Gene Symbol Slc25a21
Ensembl Gene ENSMUSG00000035472
Gene Namesolute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21
Synonyms9930033G19Rik
MMRRC Submission 039833-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R1803 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location56712634-57197472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56858087 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 54 (T54I)
Ref Sequence ENSEMBL: ENSMUSP00000151751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044634] [ENSMUST00000110680] [ENSMUST00000217690]
Predicted Effect probably benign
Transcript: ENSMUST00000044634
AA Change: T47I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000039289
Gene: ENSMUSG00000035472
AA Change: T47I

DomainStartEndE-ValueType
Pfam:Mito_carr 10 104 2.3e-24 PFAM
Pfam:Mito_carr 107 200 1.3e-16 PFAM
Pfam:Mito_carr 202 298 3.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110680
AA Change: T54I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106308
Gene: ENSMUSG00000035472
AA Change: T54I

DomainStartEndE-ValueType
Pfam:Mito_carr 28 111 4.7e-21 PFAM
Pfam:Mito_carr 114 207 7.7e-17 PFAM
Pfam:Mito_carr 209 305 2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160892
Predicted Effect probably benign
Transcript: ENSMUST00000217690
AA Change: T54I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A21 is a homolog of the S. cerevisiae ODC proteins, mitochondrial carriers that transport C5-C7 oxodicarboxylates across inner mitochondrial membranes. One of the species transported by ODC is 2-oxoadipate, a common intermediate in the catabolism of lysine, tryptophan, and hydroxylysine in mammals. Within mitochondria, 2-oxoadipate is converted into acetyl-CoA.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A T 17: 79,627,666 probably benign Het
9330182L06Rik A G 5: 9,427,832 H410R probably benign Het
Adgrl3 C T 5: 81,771,617 R586* probably null Het
Arpp21 T C 9: 112,127,398 T471A possibly damaging Het
Blnk T C 19: 40,952,377 E194G probably damaging Het
Cd44 G A 2: 102,834,252 P332S probably damaging Het
Cd47 T C 16: 49,867,806 F30L possibly damaging Het
Cdh23 T C 10: 60,331,281 E1861G probably damaging Het
Cdkal1 T A 13: 29,517,471 M332L probably damaging Het
Cul9 A G 17: 46,503,097 S2284P probably damaging Het
Cyp2a5 G T 7: 26,835,546 probably null Het
Dcp2 T C 18: 44,395,917 I33T probably damaging Het
Ddx52 A T 11: 83,946,132 I150L probably damaging Het
Ddx58 A G 4: 40,224,013 S289P probably benign Het
Dennd5a T A 7: 109,898,613 T1067S probably benign Het
Dnpep A T 1: 75,309,414 L419* probably null Het
Dock8 A G 19: 25,132,235 K927R probably benign Het
Dpy19l4 A T 4: 11,281,020 V475E possibly damaging Het
Edf1 C T 2: 25,560,194 S41F probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha3 T C 16: 63,602,288 K579E probably benign Het
Exoc1 A G 5: 76,561,441 N23S probably benign Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Flt3 C A 5: 147,367,055 E358* probably null Het
Fzd1 A T 5: 4,756,385 I399K probably damaging Het
Gdi2 T A 13: 3,564,547 Y333* probably null Het
Gm10479 A G 12: 20,433,653 H91R probably benign Het
Gm10842 G A 11: 105,147,041 R50K unknown Het
Grin2c A T 11: 115,260,732 probably null Het
Grk2 C T 19: 4,294,883 V53M probably damaging Het
H2-M10.2 C T 17: 36,285,871 M104I probably benign Het
Hyou1 C T 9: 44,384,182 Q290* probably null Het
Itgb2 T C 10: 77,564,790 S746P probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl2 T C 8: 64,759,797 E236G probably damaging Het
Krtap19-4 C A 16: 88,884,991 G26C unknown Het
Krtap4-16 G A 11: 99,851,172 T134I possibly damaging Het
Lamb2 A G 9: 108,488,099 H1318R probably benign Het
Mab21l3 G A 3: 101,835,130 T38M probably benign Het
Mfsd10 A T 5: 34,636,750 D6E possibly damaging Het
Mnat1 G T 12: 73,179,233 G91* probably null Het
Mns1 A T 9: 72,452,734 I389F probably damaging Het
Morc1 A T 16: 48,622,638 T829S probably benign Het
Morn5 T A 2: 36,053,077 V63E probably benign Het
Mybpc1 T C 10: 88,553,295 T404A possibly damaging Het
Npc1l1 A T 11: 6,228,846 M188K probably damaging Het
Nrcam T A 12: 44,572,208 M846K probably benign Het
Nup210 A C 6: 91,074,282 F373C probably damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1465 A T 19: 13,314,171 V38E possibly damaging Het
Olfr830 T C 9: 18,876,080 V248A probably damaging Het
Osbpl8 T C 10: 111,275,049 S471P probably damaging Het
Plekhn1 A T 4: 156,222,381 I517N probably benign Het
Plin4 G T 17: 56,104,931 T700K probably damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Prdm16 A T 4: 154,335,261 M897K probably damaging Het
Ptprg T A 14: 12,091,410 probably null Het
Rcan2 G T 17: 44,037,033 C211F probably damaging Het
Rxfp1 C T 3: 79,737,769 C9Y probably benign Het
Scn2a G A 2: 65,670,767 probably null Het
Scnn1a A C 6: 125,332,194 R264S probably damaging Het
Sema4g T C 19: 44,998,020 V345A probably benign Het
Sgo2b T A 8: 63,927,392 D802V probably benign Het
Slc25a46 C T 18: 31,594,588 E223K probably damaging Het
Slc25a54 A G 3: 109,102,697 I171V probably benign Het
Slc7a6 T C 8: 106,192,456 V224A possibly damaging Het
Smchd1 A T 17: 71,387,006 V1248E probably damaging Het
Sort1 C A 3: 108,325,699 F196L probably damaging Het
Sptbn4 G A 7: 27,418,583 T357M probably damaging Het
Srrm3 T A 5: 135,857,129 W308R probably damaging Het
Stard9 A T 2: 120,701,489 E2742D probably benign Het
Tas1r1 T A 4: 152,032,248 I310F probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tff1 A T 17: 31,161,586 C85* probably null Het
Tlr11 C T 14: 50,360,647 T30I probably benign Het
Trio T C 15: 27,748,340 T1265A probably benign Het
Ttc7b T C 12: 100,407,002 M338V possibly damaging Het
Umod T A 7: 119,464,724 S620C probably damaging Het
Ust C A 10: 8,298,055 probably null Het
Vmn1r176 A T 7: 23,835,184 S181R probably damaging Het
Vmn1r202 T C 13: 22,502,143 T35A probably benign Het
Vmn1r39 C A 6: 66,804,911 R104L probably benign Het
Vps13b T A 15: 35,430,205 Y286* probably null Het
Zfp579 G A 7: 4,993,770 R381C probably damaging Het
Zfp85 A G 13: 67,751,628 S71P probably benign Het
Zfyve16 A T 13: 92,504,085 V1254E probably damaging Het
Other mutations in Slc25a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Slc25a21 APN 12 56718137 splice site probably null
IGL00776:Slc25a21 APN 12 56770205 missense probably benign 0.43
IGL00788:Slc25a21 APN 12 56713812 utr 3 prime probably benign
IGL01396:Slc25a21 APN 12 57159189 missense probably benign
IGL01656:Slc25a21 APN 12 56738495 missense probably damaging 1.00
IGL03095:Slc25a21 APN 12 56738625 missense probably benign 0.09
R0285:Slc25a21 UTSW 12 56858025 critical splice donor site probably null
R1238:Slc25a21 UTSW 12 56738487 missense probably benign 0.00
R1509:Slc25a21 UTSW 12 56858079 missense probably benign 0.00
R3862:Slc25a21 UTSW 12 56718135 splice site probably benign
R4684:Slc25a21 UTSW 12 57196936 missense probably benign 0.00
R4816:Slc25a21 UTSW 12 56713838 missense probably damaging 1.00
R5718:Slc25a21 UTSW 12 56718156 missense probably benign 0.00
R6265:Slc25a21 UTSW 12 57196900 missense probably benign 0.33
R6953:Slc25a21 UTSW 12 57159169 missense probably benign
R7337:Slc25a21 UTSW 12 56858043 missense probably benign 0.03
U24488:Slc25a21 UTSW 12 56738497 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGAAGGCACACTTTTCAGAATG -3'
(R):5'- CCTGGGCTCTCATAAAGTACAAAC -3'

Sequencing Primer
(F):5'- AGGCACACTTTTCAGAATGTTTTCC -3'
(R):5'- TACTCGGGAAATACTACATTT -3'
Posted On2014-06-23