Mutagenetix > Incidental Mutations

Incidental Mutation 'R1803:Ptprg'

203323

Institutional Source

Beutler Lab

Gene Symbol

Ptprg

Ensembl Gene

ENSMUSG00000021745

Gene Name

protein tyrosine phosphatase, receptor type, G

Synonyms

5430405N12Rik, RPTPgamma

MMRRC Submission

039833-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1803 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11553532-12242041 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 12091410 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022264 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000142917] [ENSMUST00000155727]

Predicted Effect

probably null
Transcript: ENSMUST00000022264

SMART Domains

Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	321	6.38e-109	SMART
FN3	347	433	5.4e-7	SMART
low complexity region	474	484	N/A	INTRINSIC
low complexity region	515	525	N/A	INTRINSIC
coiled coil region	581	617	N/A	INTRINSIC
transmembrane domain	734	756	N/A	INTRINSIC
PTPc	844	1118	1.76e-136	SMART
PTPc	1146	1409	1.32e-85	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142917

SMART Domains

Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	260	1.6e-50	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155727

SMART Domains

Protein: ENSMUSP00000121427
Gene: ENSMUSG00000021745

Domain	Start	End	E-Value	Type
Carb_anhydrase	1	118	2.71e-6	SMART

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513D11Rik	A	T	17: 79,627,666		probably benign	Het
9330182L06Rik	A	G	5: 9,427,832	H410R	probably benign	Het
Adgrl3	C	T	5: 81,771,617	R586*	probably null	Het
Arpp21	T	C	9: 112,127,398	T471A	possibly damaging	Het
Blnk	T	C	19: 40,952,377	E194G	probably damaging	Het
Cd44	G	A	2: 102,834,252	P332S	probably damaging	Het
Cd47	T	C	16: 49,867,806	F30L	possibly damaging	Het
Cdh23	T	C	10: 60,331,281	E1861G	probably damaging	Het
Cdkal1	T	A	13: 29,517,471	M332L	probably damaging	Het
Cul9	A	G	17: 46,503,097	S2284P	probably damaging	Het
Cyp2a5	G	T	7: 26,835,546		probably null	Het
Dcp2	T	C	18: 44,395,917	I33T	probably damaging	Het
Ddx52	A	T	11: 83,946,132	I150L	probably damaging	Het
Ddx58	A	G	4: 40,224,013	S289P	probably benign	Het
Dennd5a	T	A	7: 109,898,613	T1067S	probably benign	Het
Dnpep	A	T	1: 75,309,414	L419*	probably null	Het
Dock8	A	G	19: 25,132,235	K927R	probably benign	Het
Dpy19l4	A	T	4: 11,281,020	V475E	possibly damaging	Het
Edf1	C	T	2: 25,560,194	S41F	probably damaging	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Epha3	T	C	16: 63,602,288	K579E	probably benign	Het
Exoc1	A	G	5: 76,561,441	N23S	probably benign	Het
Fam212a	A	G	9: 107,984,739	V128A	probably benign	Het
Flt3	C	A	5: 147,367,055	E358*	probably null	Het
Fzd1	A	T	5: 4,756,385	I399K	probably damaging	Het
Gdi2	T	A	13: 3,564,547	Y333*	probably null	Het
Gm10479	A	G	12: 20,433,653	H91R	probably benign	Het
Gm10842	G	A	11: 105,147,041	R50K	unknown	Het
Grin2c	A	T	11: 115,260,732		probably null	Het
Grk2	C	T	19: 4,294,883	V53M	probably damaging	Het
H2-M10.2	C	T	17: 36,285,871	M104I	probably benign	Het
Hyou1	C	T	9: 44,384,182	Q290*	probably null	Het
Itgb2	T	C	10: 77,564,790	S746P	probably benign	Het
Jmjd7	C	T	2: 120,030,108	L39F	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Klhl2	T	C	8: 64,759,797	E236G	probably damaging	Het
Krtap19-4	C	A	16: 88,884,991	G26C	unknown	Het
Krtap4-16	G	A	11: 99,851,172	T134I	possibly damaging	Het
Lamb2	A	G	9: 108,488,099	H1318R	probably benign	Het
Mab21l3	G	A	3: 101,835,130	T38M	probably benign	Het
Mfsd10	A	T	5: 34,636,750	D6E	possibly damaging	Het
Mnat1	G	T	12: 73,179,233	G91*	probably null	Het
Mns1	A	T	9: 72,452,734	I389F	probably damaging	Het
Morc1	A	T	16: 48,622,638	T829S	probably benign	Het
Morn5	T	A	2: 36,053,077	V63E	probably benign	Het
Mybpc1	T	C	10: 88,553,295	T404A	possibly damaging	Het
Npc1l1	A	T	11: 6,228,846	M188K	probably damaging	Het
Nrcam	T	A	12: 44,572,208	M846K	probably benign	Het
Nup210	A	C	6: 91,074,282	F373C	probably damaging	Het
Olfr1299	G	T	2: 111,664,754	S176I	probably damaging	Het
Olfr1465	A	T	19: 13,314,171	V38E	possibly damaging	Het
Olfr830	T	C	9: 18,876,080	V248A	probably damaging	Het
Osbpl8	T	C	10: 111,275,049	S471P	probably damaging	Het
Plekhn1	A	T	4: 156,222,381	I517N	probably benign	Het
Plin4	G	T	17: 56,104,931	T700K	probably damaging	Het
Plxna4	A	T	6: 32,517,444	V79D	probably damaging	Het
Prdm16	A	T	4: 154,335,261	M897K	probably damaging	Het
Rcan2	G	T	17: 44,037,033	C211F	probably damaging	Het
Rxfp1	C	T	3: 79,737,769	C9Y	probably benign	Het
Scn2a	G	A	2: 65,670,767		probably null	Het
Scnn1a	A	C	6: 125,332,194	R264S	probably damaging	Het
Sema4g	T	C	19: 44,998,020	V345A	probably benign	Het
Sgo2b	T	A	8: 63,927,392	D802V	probably benign	Het
Slc25a21	G	A	12: 56,858,087	T54I	probably benign	Het
Slc25a46	C	T	18: 31,594,588	E223K	probably damaging	Het
Slc25a54	A	G	3: 109,102,697	I171V	probably benign	Het
Slc7a6	T	C	8: 106,192,456	V224A	possibly damaging	Het
Smchd1	A	T	17: 71,387,006	V1248E	probably damaging	Het
Sort1	C	A	3: 108,325,699	F196L	probably damaging	Het
Sptbn4	G	A	7: 27,418,583	T357M	probably damaging	Het
Srrm3	T	A	5: 135,857,129	W308R	probably damaging	Het
Stard9	A	T	2: 120,701,489	E2742D	probably benign	Het
Tas1r1	T	A	4: 152,032,248	I310F	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tff1	A	T	17: 31,161,586	C85*	probably null	Het
Tlr11	C	T	14: 50,360,647	T30I	probably benign	Het
Trio	T	C	15: 27,748,340	T1265A	probably benign	Het
Ttc7b	T	C	12: 100,407,002	M338V	possibly damaging	Het
Umod	T	A	7: 119,464,724	S620C	probably damaging	Het
Ust	C	A	10: 8,298,055		probably null	Het
Vmn1r176	A	T	7: 23,835,184	S181R	probably damaging	Het
Vmn1r202	T	C	13: 22,502,143	T35A	probably benign	Het
Vmn1r39	C	A	6: 66,804,911	R104L	probably benign	Het
Vps13b	T	A	15: 35,430,205	Y286*	probably null	Het
Zfp579	G	A	7: 4,993,770	R381C	probably damaging	Het
Zfp85	A	G	13: 67,751,628	S71P	probably benign	Het
Zfyve16	A	T	13: 92,504,085	V1254E	probably damaging	Het

Other mutations in Ptprg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Ptprg	APN	14	12215992	missense	probably damaging	1.00
IGL00484:Ptprg	APN	14	12215220	missense	probably damaging	0.99
IGL00847:Ptprg	APN	14	12215265	missense	probably damaging	1.00
IGL01089:Ptprg	APN	14	12215286	missense	probably damaging	0.97
IGL01382:Ptprg	APN	14	12237797	missense	probably benign	0.16
IGL01470:Ptprg	APN	14	12213702	nonsense	probably null
IGL01762:Ptprg	APN	14	12037386	missense	probably benign	0.00
IGL01886:Ptprg	APN	14	12179280	missense	probably benign	0.22
IGL01963:Ptprg	APN	14	12220661	missense	probably damaging	1.00
IGL02015:Ptprg	APN	14	12237782	missense	possibly damaging	0.46
IGL02086:Ptprg	APN	14	12110080	nonsense	probably null
IGL02197:Ptprg	APN	14	12220613	missense	probably damaging	0.98
IGL02341:Ptprg	APN	14	12154360	missense	probably benign	0.00
IGL02732:Ptprg	APN	14	12225617	critical splice donor site	probably null
IGL03011:Ptprg	APN	14	12219029	missense	probably damaging	1.00
IGL03261:Ptprg	APN	14	12225552	missense	probably damaging	0.99
R0038:Ptprg	UTSW	14	12213710	missense	probably damaging	1.00
R0383:Ptprg	UTSW	14	12219024	missense	possibly damaging	0.93
R0433:Ptprg	UTSW	14	12220620	missense	probably damaging	1.00
R0488:Ptprg	UTSW	14	12220653	missense	probably damaging	1.00
R0503:Ptprg	UTSW	14	12237138	missense	possibly damaging	0.89
R0520:Ptprg	UTSW	14	12199783	missense	possibly damaging	0.92
R0570:Ptprg	UTSW	14	12215896	missense	probably damaging	1.00
R0606:Ptprg	UTSW	14	12154131	missense	probably benign
R1086:Ptprg	UTSW	14	11952706	splice site	probably benign
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1519:Ptprg	UTSW	14	12220596	missense	probably damaging	1.00
R1662:Ptprg	UTSW	14	12207357	missense	probably damaging	1.00
R1714:Ptprg	UTSW	14	12213697	missense	probably damaging	1.00
R1716:Ptprg	UTSW	14	12154360	missense	probably benign	0.00
R1797:Ptprg	UTSW	14	12199743	missense	probably damaging	1.00
R2104:Ptprg	UTSW	14	11952897	critical splice donor site	probably null
R2125:Ptprg	UTSW	14	12179283	missense	possibly damaging	0.74
R2126:Ptprg	UTSW	14	12154355	missense	probably benign
R2133:Ptprg	UTSW	14	12211637	missense	probably damaging	1.00
R2471:Ptprg	UTSW	14	12210327	missense	probably damaging	1.00
R2571:Ptprg	UTSW	14	12122135	missense	probably benign
R3821:Ptprg	UTSW	14	12226375	missense	probably benign	0.00
R4196:Ptprg	UTSW	14	12122002	missense	possibly damaging	0.51
R4392:Ptprg	UTSW	14	12142467	missense	possibly damaging	0.80
R4665:Ptprg	UTSW	14	12215288	missense	possibly damaging	0.90
R4730:Ptprg	UTSW	14	12213713	missense	probably damaging	1.00
R4737:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R4764:Ptprg	UTSW	14	12122068	missense	probably benign	0.01
R4801:Ptprg	UTSW	14	11554233	utr 5 prime	probably benign
R4825:Ptprg	UTSW	14	12220654	missense	probably damaging	1.00
R4960:Ptprg	UTSW	14	12237837	missense	probably benign	0.07
R4972:Ptprg	UTSW	14	12226427	missense	possibly damaging	0.94
R4980:Ptprg	UTSW	14	12154421	missense	probably benign	0.16
R5004:Ptprg	UTSW	14	12220667	missense	probably damaging	1.00
R5058:Ptprg	UTSW	14	12037387	missense	possibly damaging	0.82
R5182:Ptprg	UTSW	14	12154174	missense	probably benign
R5258:Ptprg	UTSW	14	12142431	missense	probably benign	0.11
R5338:Ptprg	UTSW	14	12154111	missense	probably benign
R5353:Ptprg	UTSW	14	11554235	utr 5 prime	probably benign
R5373:Ptprg	UTSW	14	12213665	missense	probably benign	0.00
R5387:Ptprg	UTSW	14	12153873	missense	probably damaging	1.00
R5616:Ptprg	UTSW	14	12122120	missense	probably benign
R5623:Ptprg	UTSW	14	12153857	missense	probably damaging	1.00
R5976:Ptprg	UTSW	14	12211625	missense	probably damaging	0.96
R6027:Ptprg	UTSW	14	12220613	missense	possibly damaging	0.87
R6091:Ptprg	UTSW	14	12215979	missense	probably damaging	1.00
R6184:Ptprg	UTSW	14	12153943	missense	probably benign	0.00
R6234:Ptprg	UTSW	14	12213747	missense	probably damaging	1.00
R6318:Ptprg	UTSW	14	12237118	missense	probably damaging	1.00
R6324:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R6334:Ptprg	UTSW	14	12166832	missense	probably damaging	1.00
R6646:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6647:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6992:Ptprg	UTSW	14	11962602	missense	probably damaging	1.00
R7088:Ptprg	UTSW	14	12207365	missense	probably damaging	1.00
R7250:Ptprg	UTSW	14	12166767	missense	probably benign	0.18
R7342:Ptprg	UTSW	14	12237151	missense	possibly damaging	0.90
R7358:Ptprg	UTSW	14	12154198	missense	possibly damaging	0.59
R7410:Ptprg	UTSW	14	11962657	missense	probably damaging	1.00
R7448:Ptprg	UTSW	14	12142461	missense	probably benign	0.12
R7514:Ptprg	UTSW	14	12179342	missense	possibly damaging	0.86
R7523:Ptprg	UTSW	14	12237130	missense	probably damaging	0.97
R7672:Ptprg	UTSW	14	12211668	missense	probably benign	0.04
R7709:Ptprg	UTSW	14	12226452	missense	probably damaging	1.00
R7720:Ptprg	UTSW	14	12211703	missense	probably benign	0.31
X0020:Ptprg	UTSW	14	12110070	frame shift	probably null
X0027:Ptprg	UTSW	14	12110070	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TAAGATTGCACTATGGAGGTGG -3'
(R):5'- AATGGTATCACCCTCGGTCC -3'

Sequencing Primer
(F):5'- CACTATGGAGGTGGTGTTTCCTCTC -3'
(R):5'- GGTCCTCTTCGAGATAACCTG -3'

Posted On

2014-06-23