Incidental Mutation 'R1803:Epha3'
ID203331
Institutional Source Beutler Lab
Gene Symbol Epha3
Ensembl Gene ENSMUSG00000052504
Gene NameEph receptor A3
SynonymsTyro4, End3, Cek4, Hek, Hek4, Mek4
MMRRC Submission 039833-MU
Accession Numbers

Genbank: NM_010140; MGI: 99612

Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R1803 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location63543534-63864175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63602288 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 579 (K579E)
Ref Sequence ENSEMBL: ENSMUSP00000155946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064405] [ENSMUST00000232049]
Predicted Effect probably benign
Transcript: ENSMUST00000064405
AA Change: K580E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066554
Gene: ENSMUSG00000052504
AA Change: K580E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EPH_lbd 29 202 1.76e-127 SMART
Pfam:GCC2_GCC3 263 306 6.6e-9 PFAM
FN3 326 418 1.14e-5 SMART
FN3 437 518 4.8e-13 SMART
Pfam:EphA2_TM 543 619 8.2e-25 PFAM
TyrKc 622 879 5.16e-140 SMART
SAM 909 976 1.08e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232049
AA Change: K579E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 48 hours of birth of cardiac failure. Survivors develop normally with no indications of cardiac abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A T 17: 79,627,666 probably benign Het
9330182L06Rik A G 5: 9,427,832 H410R probably benign Het
Adgrl3 C T 5: 81,771,617 R586* probably null Het
Arpp21 T C 9: 112,127,398 T471A possibly damaging Het
Blnk T C 19: 40,952,377 E194G probably damaging Het
Cd44 G A 2: 102,834,252 P332S probably damaging Het
Cd47 T C 16: 49,867,806 F30L possibly damaging Het
Cdh23 T C 10: 60,331,281 E1861G probably damaging Het
Cdkal1 T A 13: 29,517,471 M332L probably damaging Het
Cul9 A G 17: 46,503,097 S2284P probably damaging Het
Cyp2a5 G T 7: 26,835,546 probably null Het
Dcp2 T C 18: 44,395,917 I33T probably damaging Het
Ddx52 A T 11: 83,946,132 I150L probably damaging Het
Ddx58 A G 4: 40,224,013 S289P probably benign Het
Dennd5a T A 7: 109,898,613 T1067S probably benign Het
Dnpep A T 1: 75,309,414 L419* probably null Het
Dock8 A G 19: 25,132,235 K927R probably benign Het
Dpy19l4 A T 4: 11,281,020 V475E possibly damaging Het
Edf1 C T 2: 25,560,194 S41F probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Exoc1 A G 5: 76,561,441 N23S probably benign Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Flt3 C A 5: 147,367,055 E358* probably null Het
Fzd1 A T 5: 4,756,385 I399K probably damaging Het
Gdi2 T A 13: 3,564,547 Y333* probably null Het
Gm10479 A G 12: 20,433,653 H91R probably benign Het
Gm10842 G A 11: 105,147,041 R50K unknown Het
Grin2c A T 11: 115,260,732 probably null Het
Grk2 C T 19: 4,294,883 V53M probably damaging Het
H2-M10.2 C T 17: 36,285,871 M104I probably benign Het
Hyou1 C T 9: 44,384,182 Q290* probably null Het
Itgb2 T C 10: 77,564,790 S746P probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl2 T C 8: 64,759,797 E236G probably damaging Het
Krtap19-4 C A 16: 88,884,991 G26C unknown Het
Krtap4-16 G A 11: 99,851,172 T134I possibly damaging Het
Lamb2 A G 9: 108,488,099 H1318R probably benign Het
Mab21l3 G A 3: 101,835,130 T38M probably benign Het
Mfsd10 A T 5: 34,636,750 D6E possibly damaging Het
Mnat1 G T 12: 73,179,233 G91* probably null Het
Mns1 A T 9: 72,452,734 I389F probably damaging Het
Morc1 A T 16: 48,622,638 T829S probably benign Het
Morn5 T A 2: 36,053,077 V63E probably benign Het
Mybpc1 T C 10: 88,553,295 T404A possibly damaging Het
Npc1l1 A T 11: 6,228,846 M188K probably damaging Het
Nrcam T A 12: 44,572,208 M846K probably benign Het
Nup210 A C 6: 91,074,282 F373C probably damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1465 A T 19: 13,314,171 V38E possibly damaging Het
Olfr830 T C 9: 18,876,080 V248A probably damaging Het
Osbpl8 T C 10: 111,275,049 S471P probably damaging Het
Plekhn1 A T 4: 156,222,381 I517N probably benign Het
Plin4 G T 17: 56,104,931 T700K probably damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Prdm16 A T 4: 154,335,261 M897K probably damaging Het
Ptprg T A 14: 12,091,410 probably null Het
Rcan2 G T 17: 44,037,033 C211F probably damaging Het
Rxfp1 C T 3: 79,737,769 C9Y probably benign Het
Scn2a G A 2: 65,670,767 probably null Het
Scnn1a A C 6: 125,332,194 R264S probably damaging Het
Sema4g T C 19: 44,998,020 V345A probably benign Het
Sgo2b T A 8: 63,927,392 D802V probably benign Het
Slc25a21 G A 12: 56,858,087 T54I probably benign Het
Slc25a46 C T 18: 31,594,588 E223K probably damaging Het
Slc25a54 A G 3: 109,102,697 I171V probably benign Het
Slc7a6 T C 8: 106,192,456 V224A possibly damaging Het
Smchd1 A T 17: 71,387,006 V1248E probably damaging Het
Sort1 C A 3: 108,325,699 F196L probably damaging Het
Sptbn4 G A 7: 27,418,583 T357M probably damaging Het
Srrm3 T A 5: 135,857,129 W308R probably damaging Het
Stard9 A T 2: 120,701,489 E2742D probably benign Het
Tas1r1 T A 4: 152,032,248 I310F probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tff1 A T 17: 31,161,586 C85* probably null Het
Tlr11 C T 14: 50,360,647 T30I probably benign Het
Trio T C 15: 27,748,340 T1265A probably benign Het
Ttc7b T C 12: 100,407,002 M338V possibly damaging Het
Umod T A 7: 119,464,724 S620C probably damaging Het
Ust C A 10: 8,298,055 probably null Het
Vmn1r176 A T 7: 23,835,184 S181R probably damaging Het
Vmn1r202 T C 13: 22,502,143 T35A probably benign Het
Vmn1r39 C A 6: 66,804,911 R104L probably benign Het
Vps13b T A 15: 35,430,205 Y286* probably null Het
Zfp579 G A 7: 4,993,770 R381C probably damaging Het
Zfp85 A G 13: 67,751,628 S71P probably benign Het
Zfyve16 A T 13: 92,504,085 V1254E probably damaging Het
Other mutations in Epha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Epha3 APN 16 63566684 missense probably damaging 1.00
IGL01358:Epha3 APN 16 63595746 splice site probably benign
IGL01713:Epha3 APN 16 63552562 missense probably benign 0.00
IGL02371:Epha3 APN 16 63585020 critical splice acceptor site probably null
IGL03111:Epha3 APN 16 63653446 missense probably damaging 0.98
IGL03208:Epha3 APN 16 63611089 missense probably damaging 1.00
laterality UTSW 16 63568399 missense probably damaging 1.00
midline UTSW 16 63844144 missense possibly damaging 0.46
stride UTSW 16 63552494 missense probably benign 0.00
F2404:Epha3 UTSW 16 63546168 missense probably benign 0.14
P0041:Epha3 UTSW 16 63612868 missense probably damaging 1.00
PIT4498001:Epha3 UTSW 16 63552526 missense probably damaging 1.00
PIT4585001:Epha3 UTSW 16 63566577 critical splice donor site probably null
R0147:Epha3 UTSW 16 63612944 missense possibly damaging 0.89
R0148:Epha3 UTSW 16 63612944 missense possibly damaging 0.89
R0336:Epha3 UTSW 16 63566648 missense probably damaging 1.00
R0738:Epha3 UTSW 16 63595612 missense probably damaging 1.00
R0833:Epha3 UTSW 16 63603519 splice site probably benign
R0836:Epha3 UTSW 16 63603519 splice site probably benign
R0969:Epha3 UTSW 16 63566636 missense probably damaging 1.00
R1160:Epha3 UTSW 16 63773068 missense probably damaging 1.00
R1205:Epha3 UTSW 16 63598248 frame shift probably null
R1349:Epha3 UTSW 16 63611053 missense possibly damaging 0.89
R1372:Epha3 UTSW 16 63611053 missense possibly damaging 0.89
R1469:Epha3 UTSW 16 63653494 missense probably damaging 0.97
R1469:Epha3 UTSW 16 63653494 missense probably damaging 0.97
R1500:Epha3 UTSW 16 63595662 missense probably benign 0.06
R1523:Epha3 UTSW 16 63610948 missense probably damaging 0.99
R1532:Epha3 UTSW 16 63546178 missense probably benign 0.08
R1544:Epha3 UTSW 16 63773053 missense probably damaging 1.00
R1681:Epha3 UTSW 16 63595728 missense probably damaging 1.00
R1708:Epha3 UTSW 16 63583507 missense probably damaging 1.00
R1893:Epha3 UTSW 16 63568399 missense probably damaging 1.00
R1957:Epha3 UTSW 16 63772952 missense probably benign 0.00
R2144:Epha3 UTSW 16 63773317 missense possibly damaging 0.86
R2190:Epha3 UTSW 16 63546189 missense probably benign 0.05
R2198:Epha3 UTSW 16 63844144 missense possibly damaging 0.46
R2344:Epha3 UTSW 16 63652383 missense possibly damaging 0.67
R2504:Epha3 UTSW 16 63603625 missense probably damaging 0.97
R2911:Epha3 UTSW 16 63652412 missense probably benign
R3889:Epha3 UTSW 16 63610964 missense probably damaging 1.00
R4223:Epha3 UTSW 16 63583539 missense probably damaging 0.99
R4836:Epha3 UTSW 16 63583557 missense probably damaging 1.00
R4981:Epha3 UTSW 16 63652412 missense probably benign 0.04
R5044:Epha3 UTSW 16 63602287 missense possibly damaging 0.79
R5195:Epha3 UTSW 16 63546147 missense possibly damaging 0.86
R5248:Epha3 UTSW 16 63598257 missense probably damaging 1.00
R5478:Epha3 UTSW 16 63583533 missense probably damaging 1.00
R6052:Epha3 UTSW 16 63603604 missense possibly damaging 0.94
R6167:Epha3 UTSW 16 63612924 missense probably benign 0.00
R6337:Epha3 UTSW 16 63568443 missense probably damaging 1.00
R6342:Epha3 UTSW 16 63583500 missense probably damaging 1.00
R6793:Epha3 UTSW 16 63773455 missense probably benign 0.01
R6908:Epha3 UTSW 16 63598249 missense probably damaging 1.00
R7029:Epha3 UTSW 16 63773335 missense probably benign 0.37
R7059:Epha3 UTSW 16 63568455 missense probably damaging 1.00
R7175:Epha3 UTSW 16 63583500 missense probably damaging 1.00
R7204:Epha3 UTSW 16 63652332 missense probably benign
R7217:Epha3 UTSW 16 63552494 missense probably benign 0.00
R7315:Epha3 UTSW 16 63552609 missense probably benign 0.00
R7389:Epha3 UTSW 16 63772984 missense probably damaging 1.00
R7419:Epha3 UTSW 16 63598294 missense probably damaging 1.00
R7572:Epha3 UTSW 16 63611080 nonsense probably null
R7667:Epha3 UTSW 16 63566600 missense probably benign 0.21
R7686:Epha3 UTSW 16 63773288 missense probably damaging 1.00
R7855:Epha3 UTSW 16 63773560 missense probably damaging 1.00
R7938:Epha3 UTSW 16 63773560 missense probably damaging 1.00
Z1176:Epha3 UTSW 16 63585012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGAAACACCTCCATGGAG -3'
(R):5'- CATTAGGCAACCTTCCAGGGTAC -3'

Sequencing Primer
(F):5'- CACCTCCATGGAGAAAACATTTC -3'
(R):5'- TTCAGGGGAAAGCTTGAG -3'
Posted On2014-06-23