Mutagenetix > Incidental Mutations

Incidental Mutation 'R1803:Cul9'

203337

Institutional Source

Beutler Lab

Gene Symbol

Cul9

Ensembl Gene

ENSMUSG00000040327

Gene Name

cullin 9

Synonyms

1810035I07Rik, Parc

MMRRC Submission

039833-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.260) question?

Stock #

R1803 (G1)

Quality Score

122

Status

Not validated

Chromosome

Chromosomal Location

46500572-46546388 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46503097 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 2284 (S2284P)

Ref Sequence

ENSEMBL: ENSMUSP00000138418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046497] [ENSMUST00000066026] [ENSMUST00000182485]

Predicted Effect

probably benign
Transcript: ENSMUST00000046497

SMART Domains

Protein: ENSMUSP00000045283
Gene: ENSMUSG00000040658

Domain	Start	End	E-Value	Type
Pfam:Nuc_deoxyrib_tr	12	144	3.8e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000066026
AA Change: S2284P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327
AA Change: S2284P

Domain	Start	End	E-Value	Type
low complexity region	46	61	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	345	357	N/A	INTRINSIC
Pfam:Cul7	367	441	1e-35	PFAM
low complexity region	447	460	N/A	INTRINSIC
low complexity region	525	540	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
low complexity region	873	880	N/A	INTRINSIC
APC10	1166	1325	1.97e-56	SMART
low complexity region	1437	1450	N/A	INTRINSIC
low complexity region	1563	1578	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
Cullin_Nedd8	1867	1950	7.55e-6	SMART
Blast:RING	2074	2122	2e-13	BLAST
IBR	2144	2207	8.99e-14	SMART
IBR	2228	2283	4.66e-2	SMART
low complexity region	2503	2520	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181301

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182315

Predicted Effect

probably damaging
Transcript: ENSMUST00000182485
AA Change: S2284P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327
AA Change: S2284P

Domain	Start	End	E-Value	Type
low complexity region	46	61	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	345	357	N/A	INTRINSIC
Pfam:Cul7	367	442	1.4e-33	PFAM
low complexity region	447	460	N/A	INTRINSIC
low complexity region	525	540	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
low complexity region	873	880	N/A	INTRINSIC
APC10	1166	1325	1.97e-56	SMART
low complexity region	1437	1450	N/A	INTRINSIC
low complexity region	1563	1578	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
Cullin_Nedd8	1867	1950	7.55e-6	SMART
Blast:RING	2074	2122	3e-13	BLAST
IBR	2144	2207	8.99e-14	SMART
IBR	2228	2283	4.66e-2	SMART
coiled coil region	2461	2497	N/A	INTRINSIC
low complexity region	2513	2530	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182530

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183078

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183312

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, increased incidence of tumors, and decreased cellular sensitivity to radiation-induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513D11Rik	A	T	17: 79,627,666		probably benign	Het
9330182L06Rik	A	G	5: 9,427,832	H410R	probably benign	Het
Adgrl3	C	T	5: 81,771,617	R586*	probably null	Het
Arpp21	T	C	9: 112,127,398	T471A	possibly damaging	Het
Blnk	T	C	19: 40,952,377	E194G	probably damaging	Het
Cd44	G	A	2: 102,834,252	P332S	probably damaging	Het
Cd47	T	C	16: 49,867,806	F30L	possibly damaging	Het
Cdh23	T	C	10: 60,331,281	E1861G	probably damaging	Het
Cdkal1	T	A	13: 29,517,471	M332L	probably damaging	Het
Cyp2a5	G	T	7: 26,835,546		probably null	Het
Dcp2	T	C	18: 44,395,917	I33T	probably damaging	Het
Ddx52	A	T	11: 83,946,132	I150L	probably damaging	Het
Ddx58	A	G	4: 40,224,013	S289P	probably benign	Het
Dennd5a	T	A	7: 109,898,613	T1067S	probably benign	Het
Dnpep	A	T	1: 75,309,414	L419*	probably null	Het
Dock8	A	G	19: 25,132,235	K927R	probably benign	Het
Dpy19l4	A	T	4: 11,281,020	V475E	possibly damaging	Het
Edf1	C	T	2: 25,560,194	S41F	probably damaging	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Epha3	T	C	16: 63,602,288	K579E	probably benign	Het
Exoc1	A	G	5: 76,561,441	N23S	probably benign	Het
Fam212a	A	G	9: 107,984,739	V128A	probably benign	Het
Flt3	C	A	5: 147,367,055	E358*	probably null	Het
Fzd1	A	T	5: 4,756,385	I399K	probably damaging	Het
Gdi2	T	A	13: 3,564,547	Y333*	probably null	Het
Gm10479	A	G	12: 20,433,653	H91R	probably benign	Het
Gm10842	G	A	11: 105,147,041	R50K	unknown	Het
Grin2c	A	T	11: 115,260,732		probably null	Het
Grk2	C	T	19: 4,294,883	V53M	probably damaging	Het
H2-M10.2	C	T	17: 36,285,871	M104I	probably benign	Het
Hyou1	C	T	9: 44,384,182	Q290*	probably null	Het
Itgb2	T	C	10: 77,564,790	S746P	probably benign	Het
Jmjd7	C	T	2: 120,030,108	L39F	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Klhl2	T	C	8: 64,759,797	E236G	probably damaging	Het
Krtap19-4	C	A	16: 88,884,991	G26C	unknown	Het
Krtap4-16	G	A	11: 99,851,172	T134I	possibly damaging	Het
Lamb2	A	G	9: 108,488,099	H1318R	probably benign	Het
Mab21l3	G	A	3: 101,835,130	T38M	probably benign	Het
Mfsd10	A	T	5: 34,636,750	D6E	possibly damaging	Het
Mnat1	G	T	12: 73,179,233	G91*	probably null	Het
Mns1	A	T	9: 72,452,734	I389F	probably damaging	Het
Morc1	A	T	16: 48,622,638	T829S	probably benign	Het
Morn5	T	A	2: 36,053,077	V63E	probably benign	Het
Mybpc1	T	C	10: 88,553,295	T404A	possibly damaging	Het
Npc1l1	A	T	11: 6,228,846	M188K	probably damaging	Het
Nrcam	T	A	12: 44,572,208	M846K	probably benign	Het
Nup210	A	C	6: 91,074,282	F373C	probably damaging	Het
Olfr1299	G	T	2: 111,664,754	S176I	probably damaging	Het
Olfr1465	A	T	19: 13,314,171	V38E	possibly damaging	Het
Olfr830	T	C	9: 18,876,080	V248A	probably damaging	Het
Osbpl8	T	C	10: 111,275,049	S471P	probably damaging	Het
Plekhn1	A	T	4: 156,222,381	I517N	probably benign	Het
Plin4	G	T	17: 56,104,931	T700K	probably damaging	Het
Plxna4	A	T	6: 32,517,444	V79D	probably damaging	Het
Prdm16	A	T	4: 154,335,261	M897K	probably damaging	Het
Ptprg	T	A	14: 12,091,410		probably null	Het
Rcan2	G	T	17: 44,037,033	C211F	probably damaging	Het
Rxfp1	C	T	3: 79,737,769	C9Y	probably benign	Het
Scn2a	G	A	2: 65,670,767		probably null	Het
Scnn1a	A	C	6: 125,332,194	R264S	probably damaging	Het
Sema4g	T	C	19: 44,998,020	V345A	probably benign	Het
Sgo2b	T	A	8: 63,927,392	D802V	probably benign	Het
Slc25a21	G	A	12: 56,858,087	T54I	probably benign	Het
Slc25a46	C	T	18: 31,594,588	E223K	probably damaging	Het
Slc25a54	A	G	3: 109,102,697	I171V	probably benign	Het
Slc7a6	T	C	8: 106,192,456	V224A	possibly damaging	Het
Smchd1	A	T	17: 71,387,006	V1248E	probably damaging	Het
Sort1	C	A	3: 108,325,699	F196L	probably damaging	Het
Sptbn4	G	A	7: 27,418,583	T357M	probably damaging	Het
Srrm3	T	A	5: 135,857,129	W308R	probably damaging	Het
Stard9	A	T	2: 120,701,489	E2742D	probably benign	Het
Tas1r1	T	A	4: 152,032,248	I310F	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tff1	A	T	17: 31,161,586	C85*	probably null	Het
Tlr11	C	T	14: 50,360,647	T30I	probably benign	Het
Trio	T	C	15: 27,748,340	T1265A	probably benign	Het
Ttc7b	T	C	12: 100,407,002	M338V	possibly damaging	Het
Umod	T	A	7: 119,464,724	S620C	probably damaging	Het
Ust	C	A	10: 8,298,055		probably null	Het
Vmn1r176	A	T	7: 23,835,184	S181R	probably damaging	Het
Vmn1r202	T	C	13: 22,502,143	T35A	probably benign	Het
Vmn1r39	C	A	6: 66,804,911	R104L	probably benign	Het
Vps13b	T	A	15: 35,430,205	Y286*	probably null	Het
Zfp579	G	A	7: 4,993,770	R381C	probably damaging	Het
Zfp85	A	G	13: 67,751,628	S71P	probably benign	Het
Zfyve16	A	T	13: 92,504,085	V1254E	probably damaging	Het

Other mutations in Cul9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Cul9	APN	17	46525709	missense	probably damaging	1.00
IGL00330:Cul9	APN	17	46510841	splice site	probably benign
IGL00726:Cul9	APN	17	46528096	missense	probably damaging	1.00
IGL01020:Cul9	APN	17	46539023	missense	probably damaging	1.00
IGL01358:Cul9	APN	17	46538314	missense	probably damaging	1.00
IGL01410:Cul9	APN	17	46528646	missense	probably damaging	0.99
IGL01781:Cul9	APN	17	46539304	missense	probably benign
IGL01873:Cul9	APN	17	46502452	missense	probably damaging	0.99
IGL02117:Cul9	APN	17	46540375	missense	probably benign	0.00
IGL02300:Cul9	APN	17	46521032	splice site	probably benign
IGL02426:Cul9	APN	17	46523258	missense	possibly damaging	0.95
IGL02427:Cul9	APN	17	46502632	missense	possibly damaging	0.69
IGL02496:Cul9	APN	17	46540376	missense	possibly damaging	0.72
IGL03008:Cul9	APN	17	46502697	splice site	probably benign
IGL03059:Cul9	APN	17	46538987	missense	probably damaging	0.98
IGL03302:Cul9	APN	17	46526640	missense	probably damaging	0.98
bottlenose	UTSW	17	46500844	missense	possibly damaging	0.79
flipper	UTSW	17	46525892	missense	probably benign	0.05
orca	UTSW	17	46525135	missense	probably damaging	1.00
FR4340:Cul9	UTSW	17	46500853	small insertion	probably benign
FR4449:Cul9	UTSW	17	46500856	small insertion	probably benign
FR4737:Cul9	UTSW	17	46500846	small insertion	probably benign
FR4737:Cul9	UTSW	17	46500858	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500848	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500850	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500853	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500856	small insertion	probably benign
R0012:Cul9	UTSW	17	46538510	missense	probably benign	0.26
R0079:Cul9	UTSW	17	46537663	nonsense	probably null
R0143:Cul9	UTSW	17	46526410	missense	possibly damaging	0.65
R0390:Cul9	UTSW	17	46528589	missense	probably benign	0.34
R0401:Cul9	UTSW	17	46541704	missense	probably damaging	1.00
R0529:Cul9	UTSW	17	46520468	splice site	probably benign
R0815:Cul9	UTSW	17	46537822	splice site	probably null
R0863:Cul9	UTSW	17	46537822	splice site	probably null
R0972:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1173:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1216:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1217:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1261:Cul9	UTSW	17	46525782	missense	probably damaging	1.00
R1278:Cul9	UTSW	17	46500849	small deletion	probably benign
R1281:Cul9	UTSW	17	46511534	missense	probably damaging	1.00
R1349:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1372:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1403:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1403:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1405:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1405:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1467:Cul9	UTSW	17	46525373	missense	probably damaging	1.00
R1467:Cul9	UTSW	17	46525373	missense	probably damaging	1.00
R1482:Cul9	UTSW	17	46508547	missense	probably damaging	0.99
R1491:Cul9	UTSW	17	46538564	nonsense	probably null
R1618:Cul9	UTSW	17	46525892	missense	probably benign	0.05
R1641:Cul9	UTSW	17	46543560	missense	possibly damaging	0.96
R1679:Cul9	UTSW	17	46521156	missense	possibly damaging	0.90
R1771:Cul9	UTSW	17	46537812	missense	probably benign	0.41
R2020:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R2046:Cul9	UTSW	17	46543733	missense	probably damaging	1.00
R2056:Cul9	UTSW	17	46543372	missense	probably benign
R2088:Cul9	UTSW	17	46526649	missense	probably damaging	1.00
R2415:Cul9	UTSW	17	46543438	missense	probably benign
R2925:Cul9	UTSW	17	46510981	missense	probably benign	0.08
R2964:Cul9	UTSW	17	46502228	missense	probably damaging	0.96
R2965:Cul9	UTSW	17	46502228	missense	probably damaging	0.96
R3690:Cul9	UTSW	17	46504031	splice site	probably null
R3847:Cul9	UTSW	17	46525135	missense	probably damaging	1.00
R4437:Cul9	UTSW	17	46502159	missense	probably damaging	1.00
R4470:Cul9	UTSW	17	46538336	missense	probably benign	0.00
R4540:Cul9	UTSW	17	46503089	missense	probably null	0.98
R4555:Cul9	UTSW	17	46501829	missense	possibly damaging	0.82
R4604:Cul9	UTSW	17	46530146	missense	probably damaging	0.99
R4646:Cul9	UTSW	17	46539017	nonsense	probably null
R4799:Cul9	UTSW	17	46500844	missense	possibly damaging	0.79
R4822:Cul9	UTSW	17	46530051	missense	probably benign	0.01
R4964:Cul9	UTSW	17	46538525	missense	probably damaging	1.00
R4965:Cul9	UTSW	17	46538525	missense	probably damaging	1.00
R5027:Cul9	UTSW	17	46500782	missense	probably damaging	0.99
R5185:Cul9	UTSW	17	46525832	missense	possibly damaging	0.95
R5237:Cul9	UTSW	17	46543467	missense	probably benign	0.00
R5278:Cul9	UTSW	17	46510873	missense	probably damaging	1.00
R5361:Cul9	UTSW	17	46500849	small deletion	probably benign
R5455:Cul9	UTSW	17	46510846	splice site	probably null
R5592:Cul9	UTSW	17	46520591	missense	probably benign	0.00
R5597:Cul9	UTSW	17	46502665	missense	possibly damaging	0.56
R5613:Cul9	UTSW	17	46503844	missense	probably damaging	1.00
R6122:Cul9	UTSW	17	46521928	missense	possibly damaging	0.72
R6135:Cul9	UTSW	17	46521453	missense	probably benign
R6352:Cul9	UTSW	17	46511315	missense	probably benign	0.00
R6376:Cul9	UTSW	17	46508563	missense	probably damaging	1.00
R6868:Cul9	UTSW	17	46522183	missense	possibly damaging	0.73
R6898:Cul9	UTSW	17	46511026	missense	possibly damaging	0.87
R7090:Cul9	UTSW	17	46500839	missense	probably damaging	0.96
R7193:Cul9	UTSW	17	46538497	missense	probably damaging	0.98
R7221:Cul9	UTSW	17	46528565	missense	probably damaging	0.99
R7291:Cul9	UTSW	17	46540433	missense	probably benign	0.00
R7320:Cul9	UTSW	17	46510909	missense	possibly damaging	0.80
R7348:Cul9	UTSW	17	46510993	missense	possibly damaging	0.89
R7463:Cul9	UTSW	17	46520476	splice site	probably null
R7480:Cul9	UTSW	17	46537812	missense	probably benign	0.41
R7573:Cul9	UTSW	17	46519910	missense	probably benign
R7582:Cul9	UTSW	17	46510979	missense	probably damaging	1.00
R7605:Cul9	UTSW	17	46541732	missense	probably damaging	0.99
R7684:Cul9	UTSW	17	46509889	missense	probably damaging	1.00
R7830:Cul9	UTSW	17	46540311	missense	probably benign	0.37
R7834:Cul9	UTSW	17	46525704	splice site	probably null
R8131:Cul9	UTSW	17	46511242	missense	probably damaging	1.00
R8192:Cul9	UTSW	17	46538347	missense	probably benign	0.01
R8231:Cul9	UTSW	17	46520501	missense	probably damaging	0.99
R8248:Cul9	UTSW	17	46530014	missense	probably damaging	0.99
R8504:Cul9	UTSW	17	46503580	missense	probably damaging	1.00
R8550:Cul9	UTSW	17	46519846	missense	probably damaging	1.00
RF011:Cul9	UTSW	17	46500848	small insertion	probably benign
RF016:Cul9	UTSW	17	46500863	nonsense	probably null
RF026:Cul9	UTSW	17	46500869	nonsense	probably null
RF027:Cul9	UTSW	17	46500848	small insertion	probably benign
RF030:Cul9	UTSW	17	46500869	small insertion	probably benign
RF033:Cul9	UTSW	17	46500854	small insertion	probably benign
RF039:Cul9	UTSW	17	46500854	small insertion	probably benign
RF041:Cul9	UTSW	17	46500854	nonsense	probably null
RF042:Cul9	UTSW	17	46540615	frame shift	probably null
RF057:Cul9	UTSW	17	46500863	nonsense	probably null
Z1176:Cul9	UTSW	17	46520576	nonsense	probably null
Z1176:Cul9	UTSW	17	46520585	nonsense	probably null
Z1177:Cul9	UTSW	17	46537797	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- AGGCTTTCTTTGGTCACCTG -3'
(R):5'- CACCCAGGTTTTAAGTTGGC -3'

Sequencing Primer
(F):5'- CTGGGTGGAGGCAGAGTTCC -3'
(R):5'- CCCAGAGGAAGAGTGTATTTAGC -3'

Posted On

2014-06-23