Incidental Mutation 'R1804:Prex2'
Institutional Source Beutler Lab
Gene Symbol Prex2
Ensembl Gene ENSMUSG00000048960
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
SynonymsC030045D06Rik, 6230420N16Rik, Depdc2
MMRRC Submission 039834-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R1804 (G1)
Quality Score225
Status Validated
Chromosomal Location10993465-11303681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11132342 bp
Amino Acid Change Lysine to Glutamic Acid at position 492 (K492E)
Ref Sequence ENSEMBL: ENSMUSP00000027056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027056]
Predicted Effect probably damaging
Transcript: ENSMUST00000027056
AA Change: K492E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960
AA Change: K492E

RhoGEF 19 205 8.61e-45 SMART
PH 238 355 2.43e-12 SMART
DEP 383 456 4.46e-26 SMART
DEP 484 557 6.57e-15 SMART
PDZ 593 666 9.62e-2 SMART
PDZ 677 744 6.37e-8 SMART
low complexity region 1112 1127 N/A INTRINSIC
low complexity region 1498 1507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189822
Meta Mutation Damage Score 0.6419 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.5%
  • 20x: 89.8%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,203 Y220H probably benign Het
2610507B11Rik A G 11: 78,273,469 H1165R probably damaging Het
4930579C12Rik T C 9: 89,152,060 noncoding transcript Het
Abcc8 T C 7: 46,120,479 S871G probably benign Het
Acly T C 11: 100,515,905 Y288C probably damaging Het
Adgrb1 T A 15: 74,529,540 D128E probably damaging Het
AF529169 T A 9: 89,603,099 M82L possibly damaging Het
Alms1 C T 6: 85,621,275 Q1497* probably null Het
Cacna1c G A 6: 118,687,046 T688M probably damaging Het
Ccdc7a A T 8: 128,988,766 L279* probably null Het
Cep135 A G 5: 76,636,932 E958G probably benign Het
Clec4n G T 6: 123,230,022 V2L possibly damaging Het
Col28a1 C T 6: 8,164,612 probably null Het
Dcaf5 A G 12: 80,339,829 S508P probably benign Het
Dlgap2 C A 8: 14,727,809 N351K possibly damaging Het
Dnah8 T A 17: 30,708,407 Y1346N probably benign Het
Dqx1 T C 6: 83,060,322 V322A probably damaging Het
Ebf3 A C 7: 137,200,521 L412V possibly damaging Het
Epha5 T C 5: 84,331,815 N110S probably benign Het
Fcgbp T C 7: 28,086,139 C334R probably benign Het
Glp1r T A 17: 30,930,713 probably null Het
Gm4952 G T 19: 12,618,420 R58L probably damaging Het
Gm7579 G A 7: 142,211,938 C27Y unknown Het
Golm1 T A 13: 59,642,389 probably null Het
Gucy2g T A 19: 55,210,309 I801F probably benign Het
H2-D1 T C 17: 35,263,552 Y83H probably damaging Het
Homez A T 14: 54,857,141 I19N probably damaging Het
Hoxa5 T C 6: 52,202,648 K249R probably damaging Het
Hsd17b4 A T 18: 50,177,984 N550Y probably damaging Het
Ipo4 A T 14: 55,629,456 N668K probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klb A G 5: 65,379,853 D842G probably damaging Het
Mmp21 G T 7: 133,678,882 P120T probably benign Het
Mroh7 T A 4: 106,694,392 I918F possibly damaging Het
Muc5b A G 7: 141,863,780 T3488A possibly damaging Het
Npc1 C T 18: 12,223,088 C42Y probably damaging Het
Ogdh A G 11: 6,338,565 Y214C probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr1277 T C 2: 111,269,930 M146V probably benign Het
Olfr450 G A 6: 42,818,221 C250Y possibly damaging Het
Olfr726 A T 14: 50,083,902 W260R probably damaging Het
Olfr930 A G 9: 38,930,650 T160A possibly damaging Het
Phtf1 A G 3: 103,987,567 probably benign Het
Plb1 A G 5: 32,353,697 N1302S possibly damaging Het
Prkaa1 A G 15: 5,178,778 D509G probably benign Het
Rims2 C T 15: 39,437,043 Q57* probably null Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rraga A G 4: 86,576,444 I176V probably damaging Het
Rrm2 T C 12: 24,708,612 I51T probably benign Het
Serpina3a T A 12: 104,118,416 probably benign Het
Skint7 T C 4: 111,982,012 W168R probably damaging Het
Slc27a4 A G 2: 29,811,267 M357V probably benign Het
Slc4a3 A G 1: 75,551,717 H452R probably damaging Het
Smc1b A T 15: 85,127,790 I127K possibly damaging Het
Snap91 T A 9: 86,783,417 M383L probably benign Het
Taf6l A T 19: 8,773,634 L52Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tas2r124 A G 6: 132,755,525 I266V probably benign Het
Tesk2 T C 4: 116,800,621 probably benign Het
Tmem131l T G 3: 83,910,479 Q1237P possibly damaging Het
Tmem67 A G 4: 12,045,789 probably null Het
Tnfaip8 T A 18: 50,090,661 C179S probably damaging Het
Ush2a G A 1: 188,633,729 probably null Het
Vps13b A T 15: 35,917,137 E3709V probably damaging Het
Wdr7 A T 18: 63,865,440 S1153C probably damaging Het
Zc2hc1b A C 10: 13,171,268 probably benign Het
Zfp438 A G 18: 5,213,689 I423T probably damaging Het
Zfp592 C A 7: 81,023,695 P136T probably damaging Het
Zfp783 T A 6: 47,945,885 noncoding transcript Het
Zfp804b A T 5: 6,771,756 S400T possibly damaging Het
Other mutations in Prex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prex2 APN 1 11186652 missense possibly damaging 0.51
IGL00948:Prex2 APN 1 11170614 missense probably damaging 0.98
IGL01087:Prex2 APN 1 11068104 missense probably benign 0.00
IGL01490:Prex2 APN 1 11184545 splice site probably null
IGL01533:Prex2 APN 1 11186741 nonsense probably null
IGL01661:Prex2 APN 1 11208614 missense probably benign 0.01
IGL01668:Prex2 APN 1 11153645 missense probably benign 0.00
IGL01674:Prex2 APN 1 11170741 missense probably damaging 1.00
IGL01716:Prex2 APN 1 11266054 missense probably benign 0.04
IGL01867:Prex2 APN 1 11098503 missense probably benign 0.11
IGL01954:Prex2 APN 1 11140011 missense possibly damaging 0.75
IGL01990:Prex2 APN 1 11123233 splice site probably benign
IGL02022:Prex2 APN 1 11297739 missense probably benign 0.04
IGL02130:Prex2 APN 1 11112799 missense probably damaging 1.00
IGL02130:Prex2 APN 1 11160162 missense probably damaging 1.00
IGL02221:Prex2 APN 1 11061345 missense probably benign 0.00
IGL02369:Prex2 APN 1 11101169 critical splice donor site probably null
IGL02440:Prex2 APN 1 11153657 missense possibly damaging 0.94
IGL02477:Prex2 APN 1 11204154 missense probably benign
IGL02492:Prex2 APN 1 11123845 missense possibly damaging 0.93
IGL03051:Prex2 APN 1 11142665 missense probably damaging 1.00
IGL03154:Prex2 APN 1 11153633 missense possibly damaging 0.63
IGL03158:Prex2 APN 1 11266067 missense possibly damaging 0.89
IGL03308:Prex2 APN 1 11185175 missense possibly damaging 0.89
IGL03338:Prex2 APN 1 11140265 missense probably benign 0.01
R0042:Prex2 UTSW 1 11080081 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0138:Prex2 UTSW 1 11285043 splice site probably benign
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0208:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0325:Prex2 UTSW 1 11200057 splice site probably null
R0326:Prex2 UTSW 1 11285065 missense probably damaging 1.00
R0390:Prex2 UTSW 1 11089706 splice site probably null
R0492:Prex2 UTSW 1 11186633 splice site probably benign
R0512:Prex2 UTSW 1 11199933 missense probably benign
R0515:Prex2 UTSW 1 11199874 missense probably damaging 0.99
R0894:Prex2 UTSW 1 11181898 missense probably benign
R1259:Prex2 UTSW 1 11289270 missense probably damaging 1.00
R1332:Prex2 UTSW 1 11204091 missense probably damaging 1.00
R1356:Prex2 UTSW 1 11080092 nonsense probably null
R1451:Prex2 UTSW 1 11156259 missense probably benign 0.01
R1488:Prex2 UTSW 1 11193528 missense probably benign 0.05
R1512:Prex2 UTSW 1 11061330 missense possibly damaging 0.64
R1641:Prex2 UTSW 1 11231772 missense probably damaging 0.99
R1667:Prex2 UTSW 1 11186757 missense probably benign
R1678:Prex2 UTSW 1 11285089 missense possibly damaging 0.51
R1736:Prex2 UTSW 1 11089884 splice site probably benign
R1781:Prex2 UTSW 1 11199955 missense probably benign 0.17
R1836:Prex2 UTSW 1 11136780 missense probably damaging 1.00
R1899:Prex2 UTSW 1 11162366 nonsense probably null
R1900:Prex2 UTSW 1 11162366 nonsense probably null
R2020:Prex2 UTSW 1 11162312 missense probably damaging 0.98
R2114:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2117:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2436:Prex2 UTSW 1 11266152 missense possibly damaging 0.90
R2902:Prex2 UTSW 1 11208614 missense possibly damaging 0.77
R2915:Prex2 UTSW 1 11169853 missense probably damaging 1.00
R2924:Prex2 UTSW 1 11098487 missense probably damaging 1.00
R2981:Prex2 UTSW 1 11181962 missense probably damaging 1.00
R3430:Prex2 UTSW 1 11149854 missense possibly damaging 0.88
R3832:Prex2 UTSW 1 11156364 splice site probably benign
R3870:Prex2 UTSW 1 11160192 missense possibly damaging 0.86
R3963:Prex2 UTSW 1 11110357 missense possibly damaging 0.93
R4012:Prex2 UTSW 1 11184516 missense probably benign
R4030:Prex2 UTSW 1 11208568 missense probably benign 0.06
R4214:Prex2 UTSW 1 11101159 missense probably damaging 1.00
R4214:Prex2 UTSW 1 11285061 missense probably damaging 1.00
R4242:Prex2 UTSW 1 11156304 missense probably benign 0.06
R4490:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4491:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4492:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4561:Prex2 UTSW 1 11184545 splice site probably null
R4624:Prex2 UTSW 1 11289265 nonsense probably null
R4647:Prex2 UTSW 1 11162285 missense probably damaging 1.00
R4657:Prex2 UTSW 1 11065825 missense probably benign 0.00
R4706:Prex2 UTSW 1 11199988 missense probably damaging 1.00
R4806:Prex2 UTSW 1 11068020 missense probably damaging 1.00
R4900:Prex2 UTSW 1 11149905 splice site probably benign
R4922:Prex2 UTSW 1 11169940 missense probably damaging 1.00
R4961:Prex2 UTSW 1 11098481 missense possibly damaging 0.75
R5284:Prex2 UTSW 1 11266090 nonsense probably null
R5305:Prex2 UTSW 1 11107678 missense probably damaging 1.00
R5307:Prex2 UTSW 1 11200032 missense probably damaging 0.99
R5331:Prex2 UTSW 1 11140011 missense possibly damaging 0.75
R5385:Prex2 UTSW 1 11139980 missense probably damaging 0.99
R5574:Prex2 UTSW 1 11140058 missense probably damaging 1.00
R5979:Prex2 UTSW 1 11132372 missense probably damaging 1.00
R6076:Prex2 UTSW 1 11185950 missense probably benign 0.09
R6160:Prex2 UTSW 1 10993851 missense probably damaging 1.00
R6177:Prex2 UTSW 1 11136777 missense possibly damaging 0.49
R6221:Prex2 UTSW 1 11266012 missense probably benign 0.01
R6293:Prex2 UTSW 1 11162298 missense probably benign
R6335:Prex2 UTSW 1 11110320 missense probably benign 0.13
R6401:Prex2 UTSW 1 11186727 missense probably benign 0.00
R6427:Prex2 UTSW 1 11182031 missense probably damaging 1.00
R6467:Prex2 UTSW 1 11266035 missense probably damaging 1.00
R6564:Prex2 UTSW 1 11101061 splice site probably null
R6734:Prex2 UTSW 1 11080059 missense probably damaging 1.00
R6753:Prex2 UTSW 1 11184456 missense probably damaging 0.98
R6880:Prex2 UTSW 1 11132384 missense probably damaging 1.00
R6973:Prex2 UTSW 1 11112743 missense probably damaging 1.00
R6980:Prex2 UTSW 1 11162263 missense probably benign 0.05
R6987:Prex2 UTSW 1 11170752 missense probably damaging 0.99
R7085:Prex2 UTSW 1 11098588 missense possibly damaging 0.73
R7101:Prex2 UTSW 1 11153609 missense possibly damaging 0.86
R7106:Prex2 UTSW 1 11136793 missense probably benign 0.33
R7319:Prex2 UTSW 1 11162308 missense probably benign 0.10
R7342:Prex2 UTSW 1 11162325 missense probably benign 0.00
R7469:Prex2 UTSW 1 11285069 missense probably damaging 1.00
R7528:Prex2 UTSW 1 11204092 missense probably damaging 1.00
R7592:Prex2 UTSW 1 11123213 missense probably damaging 1.00
R7650:Prex2 UTSW 1 11149854 missense possibly damaging 0.67
R7695:Prex2 UTSW 1 11162273 missense probably benign 0.00
R7720:Prex2 UTSW 1 11181937 missense possibly damaging 0.47
R7733:Prex2 UTSW 1 11181959 missense probably benign 0.31
R7859:Prex2 UTSW 1 11080050 missense probably damaging 1.00
R8247:Prex2 UTSW 1 11199970 missense probably benign
R8300:Prex2 UTSW 1 11231718 missense possibly damaging 0.49
R8345:Prex2 UTSW 1 11199894 missense possibly damaging 0.65
R8352:Prex2 UTSW 1 11285139 missense probably benign
R8352:Prex2 UTSW 1 11285140 missense probably benign
R8410:Prex2 UTSW 1 11153657 missense possibly damaging 0.94
R8452:Prex2 UTSW 1 11285139 missense probably benign
R8452:Prex2 UTSW 1 11285140 missense probably benign
RF005:Prex2 UTSW 1 11185166 missense possibly damaging 0.47
Z1177:Prex2 UTSW 1 11289252 critical splice acceptor site probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-06-23