Incidental Mutation 'R1804:Olfr1277'
ID203357
Institutional Source Beutler Lab
Gene Symbol Olfr1277
Ensembl Gene ENSMUSG00000074965
Gene Nameolfactory receptor 1277
SynonymsMOR248-11, GA_x6K02T2Q125-72321818-72320907
MMRRC Submission 039834-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1804 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111264946-111274106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111269930 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 146 (M146V)
Ref Sequence ENSEMBL: ENSMUSP00000150703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099619] [ENSMUST00000214760]
Predicted Effect probably benign
Transcript: ENSMUST00000099619
AA Change: M146V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097214
Gene: ENSMUSG00000074965
AA Change: M146V

DomainStartEndE-ValueType
Pfam:7tm_4 31 303 5.5e-50 PFAM
Pfam:7tm_1 41 287 7.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214760
AA Change: M146V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.5%
  • 20x: 89.8%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,203 Y220H probably benign Het
2610507B11Rik A G 11: 78,273,469 H1165R probably damaging Het
4930579C12Rik T C 9: 89,152,060 noncoding transcript Het
Abcc8 T C 7: 46,120,479 S871G probably benign Het
Acly T C 11: 100,515,905 Y288C probably damaging Het
Adgrb1 T A 15: 74,529,540 D128E probably damaging Het
AF529169 T A 9: 89,603,099 M82L possibly damaging Het
Alms1 C T 6: 85,621,275 Q1497* probably null Het
Cacna1c G A 6: 118,687,046 T688M probably damaging Het
Ccdc7a A T 8: 128,988,766 L279* probably null Het
Cep135 A G 5: 76,636,932 E958G probably benign Het
Clec4n G T 6: 123,230,022 V2L possibly damaging Het
Col28a1 C T 6: 8,164,612 probably null Het
Dcaf5 A G 12: 80,339,829 S508P probably benign Het
Dlgap2 C A 8: 14,727,809 N351K possibly damaging Het
Dnah8 T A 17: 30,708,407 Y1346N probably benign Het
Dqx1 T C 6: 83,060,322 V322A probably damaging Het
Ebf3 A C 7: 137,200,521 L412V possibly damaging Het
Epha5 T C 5: 84,331,815 N110S probably benign Het
Fcgbp T C 7: 28,086,139 C334R probably benign Het
Glp1r T A 17: 30,930,713 probably null Het
Gm4952 G T 19: 12,618,420 R58L probably damaging Het
Gm7579 G A 7: 142,211,938 C27Y unknown Het
Golm1 T A 13: 59,642,389 probably null Het
Gucy2g T A 19: 55,210,309 I801F probably benign Het
H2-D1 T C 17: 35,263,552 Y83H probably damaging Het
Homez A T 14: 54,857,141 I19N probably damaging Het
Hoxa5 T C 6: 52,202,648 K249R probably damaging Het
Hsd17b4 A T 18: 50,177,984 N550Y probably damaging Het
Ipo4 A T 14: 55,629,456 N668K probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klb A G 5: 65,379,853 D842G probably damaging Het
Mmp21 G T 7: 133,678,882 P120T probably benign Het
Mroh7 T A 4: 106,694,392 I918F possibly damaging Het
Muc5b A G 7: 141,863,780 T3488A possibly damaging Het
Npc1 C T 18: 12,223,088 C42Y probably damaging Het
Ogdh A G 11: 6,338,565 Y214C probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr450 G A 6: 42,818,221 C250Y possibly damaging Het
Olfr726 A T 14: 50,083,902 W260R probably damaging Het
Olfr930 A G 9: 38,930,650 T160A possibly damaging Het
Phtf1 A G 3: 103,987,567 probably benign Het
Plb1 A G 5: 32,353,697 N1302S possibly damaging Het
Prex2 A G 1: 11,132,342 K492E probably damaging Het
Prkaa1 A G 15: 5,178,778 D509G probably benign Het
Rims2 C T 15: 39,437,043 Q57* probably null Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rraga A G 4: 86,576,444 I176V probably damaging Het
Rrm2 T C 12: 24,708,612 I51T probably benign Het
Serpina3a T A 12: 104,118,416 probably benign Het
Skint7 T C 4: 111,982,012 W168R probably damaging Het
Slc27a4 A G 2: 29,811,267 M357V probably benign Het
Slc4a3 A G 1: 75,551,717 H452R probably damaging Het
Smc1b A T 15: 85,127,790 I127K possibly damaging Het
Snap91 T A 9: 86,783,417 M383L probably benign Het
Taf6l A T 19: 8,773,634 L52Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tas2r124 A G 6: 132,755,525 I266V probably benign Het
Tesk2 T C 4: 116,800,621 probably benign Het
Tmem131l T G 3: 83,910,479 Q1237P possibly damaging Het
Tmem67 A G 4: 12,045,789 probably null Het
Tnfaip8 T A 18: 50,090,661 C179S probably damaging Het
Ush2a G A 1: 188,633,729 probably null Het
Vps13b A T 15: 35,917,137 E3709V probably damaging Het
Wdr7 A T 18: 63,865,440 S1153C probably damaging Het
Zc2hc1b A C 10: 13,171,268 probably benign Het
Zfp438 A G 18: 5,213,689 I423T probably damaging Het
Zfp592 C A 7: 81,023,695 P136T probably damaging Het
Zfp783 T A 6: 47,945,885 noncoding transcript Het
Zfp804b A T 5: 6,771,756 S400T possibly damaging Het
Other mutations in Olfr1277
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Olfr1277 APN 2 111269912 missense probably damaging 1.00
IGL02550:Olfr1277 APN 2 111270004 missense probably damaging 0.99
IGL02661:Olfr1277 APN 2 111269466 missense possibly damaging 0.56
IGL02940:Olfr1277 APN 2 111269728 missense probably damaging 0.99
R0121:Olfr1277 UTSW 2 111270314 missense probably benign 0.01
R0402:Olfr1277 UTSW 2 111269863 missense probably damaging 1.00
R0903:Olfr1277 UTSW 2 111270356 missense probably benign
R1806:Olfr1277 UTSW 2 111270277 missense possibly damaging 0.65
R1965:Olfr1277 UTSW 2 111269593 missense probably damaging 1.00
R3718:Olfr1277 UTSW 2 111270226 missense probably benign
R4044:Olfr1277 UTSW 2 111269582 missense probably benign 0.01
R4401:Olfr1277 UTSW 2 111269833 missense probably damaging 1.00
R4518:Olfr1277 UTSW 2 111269918 missense probably benign
R5309:Olfr1277 UTSW 2 111270310 missense probably benign 0.00
R5312:Olfr1277 UTSW 2 111270310 missense probably benign 0.00
R5367:Olfr1277 UTSW 2 111269890 missense possibly damaging 0.81
R5727:Olfr1277 UTSW 2 111269852 nonsense probably null
R5772:Olfr1277 UTSW 2 111269712 nonsense probably null
R5827:Olfr1277 UTSW 2 111269921 missense probably damaging 1.00
R5882:Olfr1277 UTSW 2 111270139 missense probably damaging 0.99
R6036:Olfr1277 UTSW 2 111269612 missense probably damaging 1.00
R6036:Olfr1277 UTSW 2 111269612 missense probably damaging 1.00
R6728:Olfr1277 UTSW 2 111269673 missense probably benign 0.00
R7629:Olfr1277 UTSW 2 111269876 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTAGCACACCACTGTCAG -3'
(R):5'- GTCTTTCCTCAGTAACTACACCTAAG -3'

Sequencing Primer
(F):5'- TAGCACACCACTGTCAGCATTTATC -3'
(R):5'- GATGATCATCGACTTCCTCAAGG -3'
Posted On2014-06-23