Incidental Mutation 'R1804:Zfp804b'
Institutional Source Beutler Lab
Gene Symbol Zfp804b
Ensembl Gene ENSMUSG00000092094
Gene Namezinc finger protein 804B
MMRRC Submission 039834-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R1804 (G1)
Quality Score225
Status Validated
Chromosomal Location6769010-7344756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6771756 bp
Amino Acid Change Serine to Threonine at position 400 (S400T)
Ref Sequence ENSEMBL: ENSMUSP00000130571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164784] [ENSMUST00000200317]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164784
AA Change: S400T

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130571
Gene: ENSMUSG00000092094
AA Change: S400T

ZnF_C2H2 20 44 4.81e0 SMART
low complexity region 922 934 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
low complexity region 1160 1171 N/A INTRINSIC
low complexity region 1179 1198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200317
AA Change: S436T

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094
AA Change: S436T

ZnF_C2H2 56 80 2e-2 SMART
low complexity region 958 970 N/A INTRINSIC
low complexity region 1155 1179 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1215 1234 N/A INTRINSIC
Meta Mutation Damage Score 0.1159 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.5%
  • 20x: 89.8%
Validation Efficiency 96% (77/80)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,203 Y220H probably benign Het
2610507B11Rik A G 11: 78,273,469 H1165R probably damaging Het
4930579C12Rik T C 9: 89,152,060 noncoding transcript Het
Abcc8 T C 7: 46,120,479 S871G probably benign Het
Acly T C 11: 100,515,905 Y288C probably damaging Het
Adgrb1 T A 15: 74,529,540 D128E probably damaging Het
AF529169 T A 9: 89,603,099 M82L possibly damaging Het
Alms1 C T 6: 85,621,275 Q1497* probably null Het
Cacna1c G A 6: 118,687,046 T688M probably damaging Het
Ccdc7a A T 8: 128,988,766 L279* probably null Het
Cep135 A G 5: 76,636,932 E958G probably benign Het
Clec4n G T 6: 123,230,022 V2L possibly damaging Het
Col28a1 C T 6: 8,164,612 probably null Het
Dcaf5 A G 12: 80,339,829 S508P probably benign Het
Dlgap2 C A 8: 14,727,809 N351K possibly damaging Het
Dnah8 T A 17: 30,708,407 Y1346N probably benign Het
Dqx1 T C 6: 83,060,322 V322A probably damaging Het
Ebf3 A C 7: 137,200,521 L412V possibly damaging Het
Epha5 T C 5: 84,331,815 N110S probably benign Het
Fcgbp T C 7: 28,086,139 C334R probably benign Het
Glp1r T A 17: 30,930,713 probably null Het
Gm4952 G T 19: 12,618,420 R58L probably damaging Het
Gm7579 G A 7: 142,211,938 C27Y unknown Het
Golm1 T A 13: 59,642,389 probably null Het
Gucy2g T A 19: 55,210,309 I801F probably benign Het
H2-D1 T C 17: 35,263,552 Y83H probably damaging Het
Homez A T 14: 54,857,141 I19N probably damaging Het
Hoxa5 T C 6: 52,202,648 K249R probably damaging Het
Hsd17b4 A T 18: 50,177,984 N550Y probably damaging Het
Ipo4 A T 14: 55,629,456 N668K probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klb A G 5: 65,379,853 D842G probably damaging Het
Mmp21 G T 7: 133,678,882 P120T probably benign Het
Mroh7 T A 4: 106,694,392 I918F possibly damaging Het
Muc5b A G 7: 141,863,780 T3488A possibly damaging Het
Npc1 C T 18: 12,223,088 C42Y probably damaging Het
Ogdh A G 11: 6,338,565 Y214C probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr1277 T C 2: 111,269,930 M146V probably benign Het
Olfr450 G A 6: 42,818,221 C250Y possibly damaging Het
Olfr726 A T 14: 50,083,902 W260R probably damaging Het
Olfr930 A G 9: 38,930,650 T160A possibly damaging Het
Phtf1 A G 3: 103,987,567 probably benign Het
Plb1 A G 5: 32,353,697 N1302S possibly damaging Het
Prex2 A G 1: 11,132,342 K492E probably damaging Het
Prkaa1 A G 15: 5,178,778 D509G probably benign Het
Rims2 C T 15: 39,437,043 Q57* probably null Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rraga A G 4: 86,576,444 I176V probably damaging Het
Rrm2 T C 12: 24,708,612 I51T probably benign Het
Serpina3a T A 12: 104,118,416 probably benign Het
Skint7 T C 4: 111,982,012 W168R probably damaging Het
Slc27a4 A G 2: 29,811,267 M357V probably benign Het
Slc4a3 A G 1: 75,551,717 H452R probably damaging Het
Smc1b A T 15: 85,127,790 I127K possibly damaging Het
Snap91 T A 9: 86,783,417 M383L probably benign Het
Taf6l A T 19: 8,773,634 L52Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tas2r124 A G 6: 132,755,525 I266V probably benign Het
Tesk2 T C 4: 116,800,621 probably benign Het
Tmem131l T G 3: 83,910,479 Q1237P possibly damaging Het
Tmem67 A G 4: 12,045,789 probably null Het
Tnfaip8 T A 18: 50,090,661 C179S probably damaging Het
Ush2a G A 1: 188,633,729 probably null Het
Vps13b A T 15: 35,917,137 E3709V probably damaging Het
Wdr7 A T 18: 63,865,440 S1153C probably damaging Het
Zc2hc1b A C 10: 13,171,268 probably benign Het
Zfp438 A G 18: 5,213,689 I423T probably damaging Het
Zfp592 C A 7: 81,023,695 P136T probably damaging Het
Zfp783 T A 6: 47,945,885 noncoding transcript Het
Other mutations in Zfp804b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Zfp804b APN 5 6770931 missense probably damaging 1.00
IGL01726:Zfp804b APN 5 7180707 intron probably benign
IGL02020:Zfp804b APN 5 6769118 missense probably damaging 1.00
IGL02567:Zfp804b APN 5 6769989 missense probably benign 0.02
IGL02679:Zfp804b APN 5 6771392 missense possibly damaging 0.50
IGL03245:Zfp804b APN 5 6772253 missense possibly damaging 0.92
IGL03352:Zfp804b APN 5 6770039 missense probably benign 0.45
Flush UTSW 5 6770217 missense probably benign 0.27
gozinta UTSW 5 6770153 missense possibly damaging 0.90
healthy UTSW 5 6770013 missense probably benign 0.04
Paluka UTSW 5 6770534 missense probably benign
PIT4142001:Zfp804b UTSW 5 6769422 missense probably damaging 0.99
R0025:Zfp804b UTSW 5 6771665 missense probably damaging 1.00
R0044:Zfp804b UTSW 5 6769655 missense probably damaging 1.00
R0137:Zfp804b UTSW 5 6770534 missense probably benign
R0330:Zfp804b UTSW 5 6771029 missense possibly damaging 0.83
R0330:Zfp804b UTSW 5 6771994 missense possibly damaging 0.63
R0522:Zfp804b UTSW 5 6772014 missense probably benign 0.05
R1463:Zfp804b UTSW 5 7179372 intron probably benign
R1497:Zfp804b UTSW 5 6771105 missense probably damaging 0.97
R1511:Zfp804b UTSW 5 6769771 missense possibly damaging 0.87
R1633:Zfp804b UTSW 5 7179513 intron probably benign
R1666:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1668:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1677:Zfp804b UTSW 5 7179533 intron probably benign
R1698:Zfp804b UTSW 5 6769509 missense probably damaging 1.00
R1716:Zfp804b UTSW 5 6769673 missense probably benign 0.00
R1730:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1747:Zfp804b UTSW 5 6770217 missense probably benign 0.27
R1776:Zfp804b UTSW 5 6769806 missense probably damaging 1.00
R1783:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1885:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1887:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1900:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R1929:Zfp804b UTSW 5 6769748 missense probably benign 0.05
R2141:Zfp804b UTSW 5 6772583 missense probably benign 0.11
R2181:Zfp804b UTSW 5 6771674 missense probably damaging 1.00
R2401:Zfp804b UTSW 5 6769445 missense probably damaging 1.00
R2408:Zfp804b UTSW 5 7179410 intron probably benign
R3237:Zfp804b UTSW 5 6769239 missense probably benign
R3429:Zfp804b UTSW 5 7180625 intron probably benign
R3785:Zfp804b UTSW 5 6770153 missense possibly damaging 0.90
R4459:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4460:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4608:Zfp804b UTSW 5 6772584 missense probably benign 0.04
R4762:Zfp804b UTSW 5 6772250 missense probably benign 0.00
R4871:Zfp804b UTSW 5 6876479 missense probably damaging 1.00
R4910:Zfp804b UTSW 5 6770540 missense possibly damaging 0.69
R4973:Zfp804b UTSW 5 6771198 missense probably damaging 0.99
R5199:Zfp804b UTSW 5 6770013 missense probably benign 0.04
R5219:Zfp804b UTSW 5 6770703 missense probably benign 0.01
R5411:Zfp804b UTSW 5 6770071 missense probably benign 0.00
R6001:Zfp804b UTSW 5 6769043 missense probably benign 0.00
R6041:Zfp804b UTSW 5 6771231 missense probably benign 0.08
R6151:Zfp804b UTSW 5 6769910 missense probably benign
R6252:Zfp804b UTSW 5 6769478 missense probably damaging 0.99
R6283:Zfp804b UTSW 5 6769908 missense probably benign 0.01
R6346:Zfp804b UTSW 5 6770534 missense probably benign
R6520:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R6714:Zfp804b UTSW 5 6769239 missense probably benign 0.00
R6924:Zfp804b UTSW 5 6769902 missense probably benign 0.09
R6966:Zfp804b UTSW 5 6771615 missense probably damaging 1.00
R7027:Zfp804b UTSW 5 6770372 missense probably benign
R7042:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R7076:Zfp804b UTSW 5 6769751 missense probably benign 0.02
R7099:Zfp804b UTSW 5 6772161 missense probably benign 0.37
R7574:Zfp804b UTSW 5 6772301 missense possibly damaging 0.74
R7609:Zfp804b UTSW 5 6770066 missense possibly damaging 0.90
R7654:Zfp804b UTSW 5 6769458 missense probably damaging 0.97
R7669:Zfp804b UTSW 5 6769362 missense probably damaging 1.00
R7717:Zfp804b UTSW 5 6771293 missense possibly damaging 0.50
R7721:Zfp804b UTSW 5 6771263 missense possibly damaging 0.55
R7830:Zfp804b UTSW 5 6771124 missense probably benign
R7937:Zfp804b UTSW 5 6771866 missense possibly damaging 0.49
R7941:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R8093:Zfp804b UTSW 5 6770082 missense probably benign 0.02
R8275:Zfp804b UTSW 5 6772289 missense probably benign 0.00
X0027:Zfp804b UTSW 5 6771257 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-06-23