Incidental Mutation 'R1804:Plb1'
ID203368
Institutional Source Beutler Lab
Gene Symbol Plb1
Ensembl Gene ENSMUSG00000029134
Gene Namephospholipase B1
Synonyms4930539A06Rik, 4632413E21Rik, 4930433E17Rik
MMRRC Submission 039834-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1804 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location32232708-32366520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32353697 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1302 (N1302S)
Ref Sequence ENSEMBL: ENSMUSP00000144040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202220]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101376
AA Change: N1302S

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134
AA Change: N1302S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 4e-20 PFAM
Pfam:Lipase_GDSL 745 1019 1.7e-17 PFAM
Pfam:Lipase_GDSL 1101 1367 4.6e-15 PFAM
transmembrane domain 1420 1442 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202220
AA Change: N1302S

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134
AA Change: N1302S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 4e-20 PFAM
Pfam:Lipase_GDSL 745 1019 1.7e-17 PFAM
Pfam:Lipase_GDSL 1101 1367 4.6e-15 PFAM
transmembrane domain 1420 1442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202688
Meta Mutation Damage Score 0.4066 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.5%
  • 20x: 89.8%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,203 Y220H probably benign Het
2610507B11Rik A G 11: 78,273,469 H1165R probably damaging Het
4930579C12Rik T C 9: 89,152,060 noncoding transcript Het
Abcc8 T C 7: 46,120,479 S871G probably benign Het
Acly T C 11: 100,515,905 Y288C probably damaging Het
Adgrb1 T A 15: 74,529,540 D128E probably damaging Het
AF529169 T A 9: 89,603,099 M82L possibly damaging Het
Alms1 C T 6: 85,621,275 Q1497* probably null Het
Cacna1c G A 6: 118,687,046 T688M probably damaging Het
Ccdc7a A T 8: 128,988,766 L279* probably null Het
Cep135 A G 5: 76,636,932 E958G probably benign Het
Clec4n G T 6: 123,230,022 V2L possibly damaging Het
Col28a1 C T 6: 8,164,612 probably null Het
Dcaf5 A G 12: 80,339,829 S508P probably benign Het
Dlgap2 C A 8: 14,727,809 N351K possibly damaging Het
Dnah8 T A 17: 30,708,407 Y1346N probably benign Het
Dqx1 T C 6: 83,060,322 V322A probably damaging Het
Ebf3 A C 7: 137,200,521 L412V possibly damaging Het
Epha5 T C 5: 84,331,815 N110S probably benign Het
Fcgbp T C 7: 28,086,139 C334R probably benign Het
Glp1r T A 17: 30,930,713 probably null Het
Gm4952 G T 19: 12,618,420 R58L probably damaging Het
Gm7579 G A 7: 142,211,938 C27Y unknown Het
Golm1 T A 13: 59,642,389 probably null Het
Gucy2g T A 19: 55,210,309 I801F probably benign Het
H2-D1 T C 17: 35,263,552 Y83H probably damaging Het
Homez A T 14: 54,857,141 I19N probably damaging Het
Hoxa5 T C 6: 52,202,648 K249R probably damaging Het
Hsd17b4 A T 18: 50,177,984 N550Y probably damaging Het
Ipo4 A T 14: 55,629,456 N668K probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klb A G 5: 65,379,853 D842G probably damaging Het
Mmp21 G T 7: 133,678,882 P120T probably benign Het
Mroh7 T A 4: 106,694,392 I918F possibly damaging Het
Muc5b A G 7: 141,863,780 T3488A possibly damaging Het
Npc1 C T 18: 12,223,088 C42Y probably damaging Het
Ogdh A G 11: 6,338,565 Y214C probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr1277 T C 2: 111,269,930 M146V probably benign Het
Olfr450 G A 6: 42,818,221 C250Y possibly damaging Het
Olfr726 A T 14: 50,083,902 W260R probably damaging Het
Olfr930 A G 9: 38,930,650 T160A possibly damaging Het
Phtf1 A G 3: 103,987,567 probably benign Het
Prex2 A G 1: 11,132,342 K492E probably damaging Het
Prkaa1 A G 15: 5,178,778 D509G probably benign Het
Rims2 C T 15: 39,437,043 Q57* probably null Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rraga A G 4: 86,576,444 I176V probably damaging Het
Rrm2 T C 12: 24,708,612 I51T probably benign Het
Serpina3a T A 12: 104,118,416 probably benign Het
Skint7 T C 4: 111,982,012 W168R probably damaging Het
Slc27a4 A G 2: 29,811,267 M357V probably benign Het
Slc4a3 A G 1: 75,551,717 H452R probably damaging Het
Smc1b A T 15: 85,127,790 I127K possibly damaging Het
Snap91 T A 9: 86,783,417 M383L probably benign Het
Taf6l A T 19: 8,773,634 L52Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tas2r124 A G 6: 132,755,525 I266V probably benign Het
Tesk2 T C 4: 116,800,621 probably benign Het
Tmem131l T G 3: 83,910,479 Q1237P possibly damaging Het
Tmem67 A G 4: 12,045,789 probably null Het
Tnfaip8 T A 18: 50,090,661 C179S probably damaging Het
Ush2a G A 1: 188,633,729 probably null Het
Vps13b A T 15: 35,917,137 E3709V probably damaging Het
Wdr7 A T 18: 63,865,440 S1153C probably damaging Het
Zc2hc1b A C 10: 13,171,268 probably benign Het
Zfp438 A G 18: 5,213,689 I423T probably damaging Het
Zfp592 C A 7: 81,023,695 P136T probably damaging Het
Zfp783 T A 6: 47,945,885 noncoding transcript Het
Zfp804b A T 5: 6,771,756 S400T possibly damaging Het
Other mutations in Plb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Plb1 APN 5 32345736 missense probably benign 0.00
IGL00542:Plb1 APN 5 32269834 missense probably benign 0.02
IGL00835:Plb1 APN 5 32364172 missense unknown
IGL00954:Plb1 APN 5 32298514 splice site probably benign
IGL01350:Plb1 APN 5 32317064 missense probably damaging 1.00
IGL01527:Plb1 APN 5 32317123 missense probably damaging 1.00
IGL01599:Plb1 APN 5 32342544 splice site probably benign
IGL01690:Plb1 APN 5 32313697 missense probably damaging 1.00
IGL01813:Plb1 APN 5 32329085 missense probably damaging 1.00
IGL01826:Plb1 APN 5 32281145 missense probably damaging 0.99
IGL02263:Plb1 APN 5 32321348 splice site probably benign
IGL02314:Plb1 APN 5 32281148 missense possibly damaging 0.93
IGL02649:Plb1 APN 5 32362568 missense probably benign 0.09
IGL02701:Plb1 APN 5 32364197 missense unknown
IGL02704:Plb1 APN 5 32353667 missense probably benign 0.03
IGL03170:Plb1 APN 5 32284902 missense probably damaging 0.99
IGL03182:Plb1 APN 5 32344915 splice site probably benign
IGL03326:Plb1 APN 5 32331327 missense probably benign 0.00
IGL03046:Plb1 UTSW 5 32328412 missense probably damaging 1.00
R0013:Plb1 UTSW 5 32349615 splice site probably benign
R0013:Plb1 UTSW 5 32349615 splice site probably benign
R0034:Plb1 UTSW 5 32273113 missense probably benign 0.16
R0034:Plb1 UTSW 5 32273113 missense probably benign 0.16
R0330:Plb1 UTSW 5 32355357 missense probably damaging 1.00
R0413:Plb1 UTSW 5 32355362 missense probably damaging 1.00
R0721:Plb1 UTSW 5 32364195 missense unknown
R0735:Plb1 UTSW 5 32284920 missense possibly damaging 0.90
R1423:Plb1 UTSW 5 32293257 missense probably benign
R1428:Plb1 UTSW 5 32264912 missense possibly damaging 0.82
R1469:Plb1 UTSW 5 32354826 missense possibly damaging 0.46
R1469:Plb1 UTSW 5 32354826 missense possibly damaging 0.46
R1694:Plb1 UTSW 5 32317277 missense probably null 0.01
R1801:Plb1 UTSW 5 32293243 missense probably damaging 1.00
R1900:Plb1 UTSW 5 32286847 missense probably benign 0.44
R1903:Plb1 UTSW 5 32291238 missense probably damaging 1.00
R2101:Plb1 UTSW 5 32349660 missense probably damaging 1.00
R2153:Plb1 UTSW 5 32314089 missense probably damaging 1.00
R2207:Plb1 UTSW 5 32316640 missense possibly damaging 0.50
R2270:Plb1 UTSW 5 32293242 missense probably damaging 1.00
R2271:Plb1 UTSW 5 32293242 missense probably damaging 1.00
R2311:Plb1 UTSW 5 32269818 missense probably benign 0.01
R2850:Plb1 UTSW 5 32293224 missense probably benign
R3103:Plb1 UTSW 5 32328029 missense possibly damaging 0.92
R4444:Plb1 UTSW 5 32330565 missense probably benign 0.06
R4559:Plb1 UTSW 5 32332831 missense probably damaging 0.99
R4577:Plb1 UTSW 5 32247557 nonsense probably null
R4578:Plb1 UTSW 5 32247557 nonsense probably null
R4739:Plb1 UTSW 5 32349679 splice site probably null
R4747:Plb1 UTSW 5 32349659 missense probably benign 0.08
R4806:Plb1 UTSW 5 32289852 missense probably damaging 1.00
R5406:Plb1 UTSW 5 32341915 missense probably damaging 1.00
R5567:Plb1 UTSW 5 32364199 missense unknown
R5574:Plb1 UTSW 5 32329947 missense probably benign 0.13
R5588:Plb1 UTSW 5 32329949 critical splice donor site probably null
R5619:Plb1 UTSW 5 32333497 missense probably damaging 0.99
R5769:Plb1 UTSW 5 32317522 missense probably benign 0.05
R6366:Plb1 UTSW 5 32314085 missense possibly damaging 0.59
R6700:Plb1 UTSW 5 32333464 missense probably damaging 0.99
R7162:Plb1 UTSW 5 32349663 missense probably benign 0.30
R7379:Plb1 UTSW 5 32345639 missense probably damaging 1.00
R7395:Plb1 UTSW 5 32353684 missense probably benign 0.30
R7426:Plb1 UTSW 5 32321247 intron probably null
R7643:Plb1 UTSW 5 32247557 nonsense probably null
R7657:Plb1 UTSW 5 32329867 missense probably damaging 0.98
R7780:Plb1 UTSW 5 32326266 intron probably null
R8040:Plb1 UTSW 5 32273069 missense possibly damaging 0.89
R8212:Plb1 UTSW 5 32264906 missense probably damaging 1.00
X0018:Plb1 UTSW 5 32285883 missense probably benign 0.01
X0019:Plb1 UTSW 5 32353697 missense probably damaging 0.99
X0027:Plb1 UTSW 5 32270358 missense probably benign
X0028:Plb1 UTSW 5 32302675 missense probably damaging 1.00
Z1088:Plb1 UTSW 5 32310917 missense probably benign
Z1088:Plb1 UTSW 5 32310847 missense probably damaging 0.99
Z1177:Plb1 UTSW 5 32284897 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CATTTAGTGGCACAGACTGC -3'
(R):5'- CTGTGTATCATCTGCTCTGAAGG -3'

Sequencing Primer
(F):5'- ACAGACTGCACCATGTGG -3'
(R):5'- ATCATCTGCTCTGAAGGCTGGG -3'
Posted On2014-06-23