Mutagenetix > Incidental Mutations

Incidental Mutation 'R1804:Klb'

203369

Institutional Source

Beutler Lab

Gene Symbol

Klb

Ensembl Gene

ENSMUSG00000029195

Gene Name

klotho beta

Synonyms

betaKlotho

MMRRC Submission

039834-MU

Accession Numbers

Genbank: NM_031180.2; Ensembl: ENSMUST00000031096;

MGI:1932466

Is this an essential gene?

Probably essential (E-score: 0.907) question?

Stock #

R1804 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65348314-65384007 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65379853 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 842 (D842G)

Ref Sequence

ENSEMBL: ENSMUSP00000031096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031096] [ENSMUST00000205084]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031096
AA Change: D842G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031096
Gene: ENSMUSG00000029195
AA Change: D842G

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	77	385	8.8e-96	PFAM
Pfam:Glyco_hydro_1	374	506	1.7e-31	PFAM
Pfam:Glyco_hydro_1	515	965	6.3e-80	PFAM
transmembrane domain	995	1017	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205084

SMART Domains

Protein: ENSMUSP00000145091
Gene: ENSMUSG00000029195

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	77	360	8.6e-94	PFAM

Meta Mutation Damage Score

0.4201

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.5%
20x: 89.8%

Validation Efficiency

96% (77/80)

MGI Phenotype

Strain: 3587748
PHENOTYPE: Homozygous null mice display increased bile acid synthesis and excretion, resistance to gallstone formation, and slightly decreased body weight. Mice homozygous for a knock-out allele or a conditional allele activated in adipose tissue exhibit resistanceto FGF21-induced metabolic disruptions. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	A	G	1: 184,033,203	Y220H	probably benign	Het
2610507B11Rik	A	G	11: 78,273,469	H1165R	probably damaging	Het
4930579C12Rik	T	C	9: 89,152,060		noncoding transcript	Het
Abcc8	T	C	7: 46,120,479	S871G	probably benign	Het
Acly	T	C	11: 100,515,905	Y288C	probably damaging	Het
Adgrb1	T	A	15: 74,529,540	D128E	probably damaging	Het
AF529169	T	A	9: 89,603,099	M82L	possibly damaging	Het
Alms1	C	T	6: 85,621,275	Q1497*	probably null	Het
Cacna1c	G	A	6: 118,687,046	T688M	probably damaging	Het
Ccdc7a	A	T	8: 128,988,766	L279*	probably null	Het
Cep135	A	G	5: 76,636,932	E958G	probably benign	Het
Clec4n	G	T	6: 123,230,022	V2L	possibly damaging	Het
Col28a1	C	T	6: 8,164,612		probably null	Het
Dcaf5	A	G	12: 80,339,829	S508P	probably benign	Het
Dlgap2	C	A	8: 14,727,809	N351K	possibly damaging	Het
Dnah8	T	A	17: 30,708,407	Y1346N	probably benign	Het
Dqx1	T	C	6: 83,060,322	V322A	probably damaging	Het
Ebf3	A	C	7: 137,200,521	L412V	possibly damaging	Het
Epha5	T	C	5: 84,331,815	N110S	probably benign	Het
Fcgbp	T	C	7: 28,086,139	C334R	probably benign	Het
Glp1r	T	A	17: 30,930,713		probably null	Het
Gm4952	G	T	19: 12,618,420	R58L	probably damaging	Het
Gm7579	G	A	7: 142,211,938	C27Y	unknown	Het
Golm1	T	A	13: 59,642,389		probably null	Het
Gucy2g	T	A	19: 55,210,309	I801F	probably benign	Het
H2-D1	T	C	17: 35,263,552	Y83H	probably damaging	Het
Homez	A	T	14: 54,857,141	I19N	probably damaging	Het
Hoxa5	T	C	6: 52,202,648	K249R	probably damaging	Het
Hsd17b4	A	T	18: 50,177,984	N550Y	probably damaging	Het
Ipo4	A	T	14: 55,629,456	N668K	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Mmp21	G	T	7: 133,678,882	P120T	probably benign	Het
Mroh7	T	A	4: 106,694,392	I918F	possibly damaging	Het
Muc5b	A	G	7: 141,863,780	T3488A	possibly damaging	Het
Npc1	C	T	18: 12,223,088	C42Y	probably damaging	Het
Ogdh	A	G	11: 6,338,565	Y214C	probably damaging	Het
Olfr1042	G	T	2: 86,160,073	T99N	probably benign	Het
Olfr1277	T	C	2: 111,269,930	M146V	probably benign	Het
Olfr450	G	A	6: 42,818,221	C250Y	possibly damaging	Het
Olfr726	A	T	14: 50,083,902	W260R	probably damaging	Het
Olfr930	A	G	9: 38,930,650	T160A	possibly damaging	Het
Phtf1	A	G	3: 103,987,567		probably benign	Het
Plb1	A	G	5: 32,353,697	N1302S	possibly damaging	Het
Prex2	A	G	1: 11,132,342	K492E	probably damaging	Het
Prkaa1	A	G	15: 5,178,778	D509G	probably benign	Het
Rims2	C	T	15: 39,437,043	Q57*	probably null	Het
Rnf40	T	C	7: 127,595,948	V411A	possibly damaging	Het
Rraga	A	G	4: 86,576,444	I176V	probably damaging	Het
Rrm2	T	C	12: 24,708,612	I51T	probably benign	Het
Serpina3a	T	A	12: 104,118,416		probably benign	Het
Skint7	T	C	4: 111,982,012	W168R	probably damaging	Het
Slc27a4	A	G	2: 29,811,267	M357V	probably benign	Het
Slc4a3	A	G	1: 75,551,717	H452R	probably damaging	Het
Smc1b	A	T	15: 85,127,790	I127K	possibly damaging	Het
Snap91	T	A	9: 86,783,417	M383L	probably benign	Het
Taf6l	A	T	19: 8,773,634	L52Q	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tas2r124	A	G	6: 132,755,525	I266V	probably benign	Het
Tesk2	T	C	4: 116,800,621		probably benign	Het
Tmem131l	T	G	3: 83,910,479	Q1237P	possibly damaging	Het
Tmem67	A	G	4: 12,045,789		probably null	Het
Tnfaip8	T	A	18: 50,090,661	C179S	probably damaging	Het
Ush2a	G	A	1: 188,633,729		probably null	Het
Vps13b	A	T	15: 35,917,137	E3709V	probably damaging	Het
Wdr7	A	T	18: 63,865,440	S1153C	probably damaging	Het
Zc2hc1b	A	C	10: 13,171,268		probably benign	Het
Zfp438	A	G	18: 5,213,689	I423T	probably damaging	Het
Zfp592	C	A	7: 81,023,695	P136T	probably damaging	Het
Zfp783	T	A	6: 47,945,885		noncoding transcript	Het
Zfp804b	A	T	5: 6,771,756	S400T	possibly damaging	Het

Other mutations in Klb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Klb	APN	5	65372374	missense	possibly damaging	0.90
IGL00821:Klb	APN	5	65372149	missense	probably damaging	1.00
IGL01082:Klb	APN	5	65375940	missense	possibly damaging	0.71
IGL01637:Klb	APN	5	65375679	critical splice acceptor site	probably null
IGL02098:Klb	APN	5	65379885	missense	probably benign	0.21
IGL03113:Klb	APN	5	65383470	missense	probably benign	0.00
1mM(1):Klb	UTSW	5	65348650	missense	probably damaging	1.00
P0016:Klb	UTSW	5	65379923	nonsense	probably null
R0268:Klb	UTSW	5	65348837	missense	probably benign	0.02
R0383:Klb	UTSW	5	65372499	splice site	probably null
R0676:Klb	UTSW	5	65379055	missense	probably damaging	1.00
R0735:Klb	UTSW	5	65379727	missense	probably benign
R0972:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1051:Klb	UTSW	5	65379327	missense	probably damaging	1.00
R1168:Klb	UTSW	5	65378974	missense	probably damaging	1.00
R1372:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1403:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1403:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1446:Klb	UTSW	5	65348995	missense	probably damaging	1.00
R1696:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1743:Klb	UTSW	5	65375861	missense	probably damaging	0.99
R1801:Klb	UTSW	5	65349235	missense	probably null	0.90
R1848:Klb	UTSW	5	65348837	missense	probably benign	0.02
R1967:Klb	UTSW	5	65372074	missense	probably damaging	0.98
R3420:Klb	UTSW	5	65372142	missense	probably damaging	1.00
R4397:Klb	UTSW	5	65380039	missense	probably damaging	1.00
R4490:Klb	UTSW	5	65375794	missense	probably benign	0.02
R4491:Klb	UTSW	5	65375794	missense	probably benign	0.02
R4547:Klb	UTSW	5	65379928	missense	probably benign	0.00
R4878:Klb	UTSW	5	65348490	missense	probably damaging	0.99
R5269:Klb	UTSW	5	65348797	missense	probably damaging	1.00
R5418:Klb	UTSW	5	65383470	missense	probably benign	0.00
R5453:Klb	UTSW	5	65383385	missense	probably benign	0.08
R5541:Klb	UTSW	5	65379234	missense	probably benign	0.27
R5672:Klb	UTSW	5	65379949	missense	possibly damaging	0.82
R5841:Klb	UTSW	5	65379324	nonsense	probably null
R6088:Klb	UTSW	5	65349013	missense	probably benign	0.07
R6807:Klb	UTSW	5	65379534	missense	probably damaging	1.00
R6955:Klb	UTSW	5	65379088	nonsense	probably null
R7068:Klb	UTSW	5	65379340	missense	probably damaging	1.00
R7284:Klb	UTSW	5	65383478	missense	probably benign	0.01
R7322:Klb	UTSW	5	65383364	missense	probably benign	0.44
R7346:Klb	UTSW	5	65348631	nonsense	probably null
R7366:Klb	UTSW	5	65372431	missense	probably damaging	1.00
R8134:Klb	UTSW	5	65383615	missense	probably benign	0.00
R8243:Klb	UTSW	5	65378995	missense	possibly damaging	0.65
R8409:Klb	UTSW	5	65379535	missense	probably damaging	0.96
Z1177:Klb	UTSW	5	65348741	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCGCCTGGTTTGCAGATCC -3'
(R):5'- GATCTGATCATCCTCTAGAGCCAG -3'

Sequencing Primer
(F):5'- GCGACTATCCATCGGTTATGAAG -3'
(R):5'- TCTAGAGCCAGGTCATCGATG -3'

Posted On

2014-06-23