Incidental Mutation 'R1804:Clec4n'
ID203378
Institutional Source Beutler Lab
Gene Symbol Clec4n
Ensembl Gene ENSMUSG00000023349
Gene NameC-type lectin domain family 4, member n
Synonymsdectin-2, Clecsf10, Nkcl
MMRRC Submission 039834-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1804 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123229843-123247021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 123230022 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 2 (V2L)
Ref Sequence ENSEMBL: ENSMUSP00000120043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024118] [ENSMUST00000112554] [ENSMUST00000117130] [ENSMUST00000151714] [ENSMUST00000205129]
Predicted Effect probably benign
Transcript: ENSMUST00000024118
AA Change: V2L

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000024118
Gene: ENSMUSG00000023349
AA Change: V2L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
CLECT 79 203 5.89e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112554
AA Change: V2L

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108173
Gene: ENSMUSG00000023349
AA Change: V2L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 45 169 5.89e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117130
AA Change: V2L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113733
Gene: ENSMUSG00000023349
AA Change: V2L

DomainStartEndE-ValueType
CLECT 49 173 5.89e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144840
Predicted Effect possibly damaging
Transcript: ENSMUST00000151714
AA Change: V2L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120043
Gene: ENSMUSG00000023349
AA Change: V2L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205129
AA Change: V2L

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000145023
Gene: ENSMUSG00000023349
AA Change: V2L

DomainStartEndE-ValueType
Blast:CLECT 26 72 3e-13 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.5%
  • 20x: 89.8%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane receptor with an extracellular C-type lectin-like domain fold. The extracellular portion binds structures with a high mannose content and has been shown to recognize several pathogens, including C. elegans, S. cerevisiae, M. tuberculosis, C. neoformans, and house dust mite. When stimulated, the encoded protein initiates signalling through the CARD9-Bcl10-Malt1 pathway, leading to the induction of cytokines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele have defective responses to Candida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,203 Y220H probably benign Het
2610507B11Rik A G 11: 78,273,469 H1165R probably damaging Het
4930579C12Rik T C 9: 89,152,060 noncoding transcript Het
Abcc8 T C 7: 46,120,479 S871G probably benign Het
Acly T C 11: 100,515,905 Y288C probably damaging Het
Adgrb1 T A 15: 74,529,540 D128E probably damaging Het
AF529169 T A 9: 89,603,099 M82L possibly damaging Het
Alms1 C T 6: 85,621,275 Q1497* probably null Het
Cacna1c G A 6: 118,687,046 T688M probably damaging Het
Ccdc7a A T 8: 128,988,766 L279* probably null Het
Cep135 A G 5: 76,636,932 E958G probably benign Het
Col28a1 C T 6: 8,164,612 probably null Het
Dcaf5 A G 12: 80,339,829 S508P probably benign Het
Dlgap2 C A 8: 14,727,809 N351K possibly damaging Het
Dnah8 T A 17: 30,708,407 Y1346N probably benign Het
Dqx1 T C 6: 83,060,322 V322A probably damaging Het
Ebf3 A C 7: 137,200,521 L412V possibly damaging Het
Epha5 T C 5: 84,331,815 N110S probably benign Het
Fcgbp T C 7: 28,086,139 C334R probably benign Het
Glp1r T A 17: 30,930,713 probably null Het
Gm4952 G T 19: 12,618,420 R58L probably damaging Het
Gm7579 G A 7: 142,211,938 C27Y unknown Het
Golm1 T A 13: 59,642,389 probably null Het
Gucy2g T A 19: 55,210,309 I801F probably benign Het
H2-D1 T C 17: 35,263,552 Y83H probably damaging Het
Homez A T 14: 54,857,141 I19N probably damaging Het
Hoxa5 T C 6: 52,202,648 K249R probably damaging Het
Hsd17b4 A T 18: 50,177,984 N550Y probably damaging Het
Ipo4 A T 14: 55,629,456 N668K probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klb A G 5: 65,379,853 D842G probably damaging Het
Mmp21 G T 7: 133,678,882 P120T probably benign Het
Mroh7 T A 4: 106,694,392 I918F possibly damaging Het
Muc5b A G 7: 141,863,780 T3488A possibly damaging Het
Npc1 C T 18: 12,223,088 C42Y probably damaging Het
Ogdh A G 11: 6,338,565 Y214C probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr1277 T C 2: 111,269,930 M146V probably benign Het
Olfr450 G A 6: 42,818,221 C250Y possibly damaging Het
Olfr726 A T 14: 50,083,902 W260R probably damaging Het
Olfr930 A G 9: 38,930,650 T160A possibly damaging Het
Phtf1 A G 3: 103,987,567 probably benign Het
Plb1 A G 5: 32,353,697 N1302S possibly damaging Het
Prex2 A G 1: 11,132,342 K492E probably damaging Het
Prkaa1 A G 15: 5,178,778 D509G probably benign Het
Rims2 C T 15: 39,437,043 Q57* probably null Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rraga A G 4: 86,576,444 I176V probably damaging Het
Rrm2 T C 12: 24,708,612 I51T probably benign Het
Serpina3a T A 12: 104,118,416 probably benign Het
Skint7 T C 4: 111,982,012 W168R probably damaging Het
Slc27a4 A G 2: 29,811,267 M357V probably benign Het
Slc4a3 A G 1: 75,551,717 H452R probably damaging Het
Smc1b A T 15: 85,127,790 I127K possibly damaging Het
Snap91 T A 9: 86,783,417 M383L probably benign Het
Taf6l A T 19: 8,773,634 L52Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tas2r124 A G 6: 132,755,525 I266V probably benign Het
Tesk2 T C 4: 116,800,621 probably benign Het
Tmem131l T G 3: 83,910,479 Q1237P possibly damaging Het
Tmem67 A G 4: 12,045,789 probably null Het
Tnfaip8 T A 18: 50,090,661 C179S probably damaging Het
Ush2a G A 1: 188,633,729 probably null Het
Vps13b A T 15: 35,917,137 E3709V probably damaging Het
Wdr7 A T 18: 63,865,440 S1153C probably damaging Het
Zc2hc1b A C 10: 13,171,268 probably benign Het
Zfp438 A G 18: 5,213,689 I423T probably damaging Het
Zfp592 C A 7: 81,023,695 P136T probably damaging Het
Zfp783 T A 6: 47,945,885 noncoding transcript Het
Zfp804b A T 5: 6,771,756 S400T possibly damaging Het
Other mutations in Clec4n
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Clec4n APN 6 123244474 intron probably benign
IGL02248:Clec4n APN 6 123230568 missense probably damaging 0.99
IGL03181:Clec4n APN 6 123230515 missense possibly damaging 0.90
IGL03293:Clec4n APN 6 123232146 missense probably benign 0.10
P4717OSA:Clec4n UTSW 6 123244540 missense probably damaging 0.97
P4748:Clec4n UTSW 6 123244540 missense probably damaging 0.97
R1137:Clec4n UTSW 6 123246567 missense possibly damaging 0.80
R1445:Clec4n UTSW 6 123235516 missense probably benign 0.01
R1538:Clec4n UTSW 6 123230033 missense possibly damaging 0.66
R1960:Clec4n UTSW 6 123230546 missense probably damaging 0.99
R2046:Clec4n UTSW 6 123246504 missense probably benign 0.00
R4097:Clec4n UTSW 6 123230741 missense possibly damaging 0.66
R4657:Clec4n UTSW 6 123232196 critical splice donor site probably null
R4967:Clec4n UTSW 6 123232107 missense probably benign 0.41
R5471:Clec4n UTSW 6 123232186 missense probably benign 0.06
R6703:Clec4n UTSW 6 123235594 missense probably null 1.00
R7411:Clec4n UTSW 6 123232186 missense probably benign 0.06
R7877:Clec4n UTSW 6 123232104 missense probably benign 0.02
R7960:Clec4n UTSW 6 123232104 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGACTTCTGGGTTTGCAGC -3'
(R):5'- GGCACCTGCAATTTCCATG -3'

Sequencing Primer
(F):5'- TTTGCAGCATTGGCCCG -3'
(R):5'- GGGCTTCTGGCTCTGAGATATTATAC -3'
Posted On2014-06-23