Incidental Mutation 'R1804:Zfp592'
ID203382
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Namezinc finger protein 592
Synonyms
MMRRC Submission 039834-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R1804 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80993681-81045164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81023695 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 136 (P136T)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
Predicted Effect probably damaging
Transcript: ENSMUST00000107353
AA Change: P136T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: P136T

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176477
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.5%
  • 20x: 89.8%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,203 Y220H probably benign Het
2610507B11Rik A G 11: 78,273,469 H1165R probably damaging Het
4930579C12Rik T C 9: 89,152,060 noncoding transcript Het
Abcc8 T C 7: 46,120,479 S871G probably benign Het
Acly T C 11: 100,515,905 Y288C probably damaging Het
Adgrb1 T A 15: 74,529,540 D128E probably damaging Het
AF529169 T A 9: 89,603,099 M82L possibly damaging Het
Alms1 C T 6: 85,621,275 Q1497* probably null Het
Cacna1c G A 6: 118,687,046 T688M probably damaging Het
Ccdc7a A T 8: 128,988,766 L279* probably null Het
Cep135 A G 5: 76,636,932 E958G probably benign Het
Clec4n G T 6: 123,230,022 V2L possibly damaging Het
Col28a1 C T 6: 8,164,612 probably null Het
Dcaf5 A G 12: 80,339,829 S508P probably benign Het
Dlgap2 C A 8: 14,727,809 N351K possibly damaging Het
Dnah8 T A 17: 30,708,407 Y1346N probably benign Het
Dqx1 T C 6: 83,060,322 V322A probably damaging Het
Ebf3 A C 7: 137,200,521 L412V possibly damaging Het
Epha5 T C 5: 84,331,815 N110S probably benign Het
Fcgbp T C 7: 28,086,139 C334R probably benign Het
Glp1r T A 17: 30,930,713 probably null Het
Gm4952 G T 19: 12,618,420 R58L probably damaging Het
Gm7579 G A 7: 142,211,938 C27Y unknown Het
Golm1 T A 13: 59,642,389 probably null Het
Gucy2g T A 19: 55,210,309 I801F probably benign Het
H2-D1 T C 17: 35,263,552 Y83H probably damaging Het
Homez A T 14: 54,857,141 I19N probably damaging Het
Hoxa5 T C 6: 52,202,648 K249R probably damaging Het
Hsd17b4 A T 18: 50,177,984 N550Y probably damaging Het
Ipo4 A T 14: 55,629,456 N668K probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klb A G 5: 65,379,853 D842G probably damaging Het
Mmp21 G T 7: 133,678,882 P120T probably benign Het
Mroh7 T A 4: 106,694,392 I918F possibly damaging Het
Muc5b A G 7: 141,863,780 T3488A possibly damaging Het
Npc1 C T 18: 12,223,088 C42Y probably damaging Het
Ogdh A G 11: 6,338,565 Y214C probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr1277 T C 2: 111,269,930 M146V probably benign Het
Olfr450 G A 6: 42,818,221 C250Y possibly damaging Het
Olfr726 A T 14: 50,083,902 W260R probably damaging Het
Olfr930 A G 9: 38,930,650 T160A possibly damaging Het
Phtf1 A G 3: 103,987,567 probably benign Het
Plb1 A G 5: 32,353,697 N1302S possibly damaging Het
Prex2 A G 1: 11,132,342 K492E probably damaging Het
Prkaa1 A G 15: 5,178,778 D509G probably benign Het
Rims2 C T 15: 39,437,043 Q57* probably null Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rraga A G 4: 86,576,444 I176V probably damaging Het
Rrm2 T C 12: 24,708,612 I51T probably benign Het
Serpina3a T A 12: 104,118,416 probably benign Het
Skint7 T C 4: 111,982,012 W168R probably damaging Het
Slc27a4 A G 2: 29,811,267 M357V probably benign Het
Slc4a3 A G 1: 75,551,717 H452R probably damaging Het
Smc1b A T 15: 85,127,790 I127K possibly damaging Het
Snap91 T A 9: 86,783,417 M383L probably benign Het
Taf6l A T 19: 8,773,634 L52Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tas2r124 A G 6: 132,755,525 I266V probably benign Het
Tesk2 T C 4: 116,800,621 probably benign Het
Tmem131l T G 3: 83,910,479 Q1237P possibly damaging Het
Tmem67 A G 4: 12,045,789 probably null Het
Tnfaip8 T A 18: 50,090,661 C179S probably damaging Het
Ush2a G A 1: 188,633,729 probably null Het
Vps13b A T 15: 35,917,137 E3709V probably damaging Het
Wdr7 A T 18: 63,865,440 S1153C probably damaging Het
Zc2hc1b A C 10: 13,171,268 probably benign Het
Zfp438 A G 18: 5,213,689 I423T probably damaging Het
Zfp783 T A 6: 47,945,885 noncoding transcript Het
Zfp804b A T 5: 6,771,756 S400T possibly damaging Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 81041548 nonsense probably null
IGL01984:Zfp592 APN 7 81038644 missense probably benign 0.00
IGL02079:Zfp592 APN 7 81039230 missense probably benign 0.20
IGL02096:Zfp592 APN 7 81025048 missense probably damaging 1.00
IGL02125:Zfp592 APN 7 81038184 missense probably benign 0.00
IGL02374:Zfp592 APN 7 81024983 missense probably damaging 1.00
IGL02419:Zfp592 APN 7 81038245 missense probably damaging 1.00
IGL02466:Zfp592 APN 7 81023998 missense probably damaging 1.00
IGL02485:Zfp592 APN 7 81037970 splice site probably benign
IGL02500:Zfp592 APN 7 81041726 missense probably benign
IGL02876:Zfp592 APN 7 81038127 missense probably benign 0.01
IGL02940:Zfp592 APN 7 81024827 missense probably damaging 1.00
R0326:Zfp592 UTSW 7 81024889 missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 81038071 missense probably damaging 1.00
R0684:Zfp592 UTSW 7 81037875 missense probably benign 0.00
R0750:Zfp592 UTSW 7 81024745 missense probably benign
R1346:Zfp592 UTSW 7 81038064 missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 81024479 missense probably damaging 0.99
R1650:Zfp592 UTSW 7 81038100 missense probably benign 0.04
R1918:Zfp592 UTSW 7 81037420 nonsense probably null
R2114:Zfp592 UTSW 7 81024796 missense probably damaging 1.00
R2144:Zfp592 UTSW 7 81038202 missense probably benign 0.01
R2164:Zfp592 UTSW 7 81041438 missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 81041613 missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 81037411 nonsense probably null
R3809:Zfp592 UTSW 7 81024532 missense probably benign 0.00
R4574:Zfp592 UTSW 7 81023786 missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 81041859 missense probably damaging 1.00
R5023:Zfp592 UTSW 7 81024347 missense probably damaging 1.00
R5121:Zfp592 UTSW 7 81023561 missense probably damaging 1.00
R5174:Zfp592 UTSW 7 81038325 missense probably damaging 1.00
R5794:Zfp592 UTSW 7 81025033 missense probably benign 0.00
R5946:Zfp592 UTSW 7 81037897 missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 81023436 missense probably benign 0.05
R6657:Zfp592 UTSW 7 81025486 missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R6872:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R7056:Zfp592 UTSW 7 81023319 missense probably damaging 1.00
R7295:Zfp592 UTSW 7 81024322 missense probably damaging 1.00
R7351:Zfp592 UTSW 7 81041691 missense probably benign 0.00
R7475:Zfp592 UTSW 7 81023452 missense probably damaging 0.99
R7509:Zfp592 UTSW 7 81038340 missense probably damaging 0.99
R7552:Zfp592 UTSW 7 81023642 missense probably benign 0.01
R7737:Zfp592 UTSW 7 81025193 missense probably damaging 1.00
R7752:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R7901:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R7984:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R8100:Zfp592 UTSW 7 81024192 missense probably benign 0.05
X0022:Zfp592 UTSW 7 81038187 nonsense probably null
X0028:Zfp592 UTSW 7 81024014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCGTGAGTGTCATTGTC -3'
(R):5'- TGATCAAACATGTGTAGTTCCGGG -3'

Sequencing Primer
(F):5'- CGTGAGTGTCATTGTCAAGAACACC -3'
(R):5'- GACTGGGAATTTTGACAGAGCTTCC -3'
Posted On2014-06-23