Incidental Mutation 'R1804:Mmp21'
ID203384
Institutional Source Beutler Lab
Gene Symbol Mmp21
Ensembl Gene ENSMUSG00000030981
Gene Namematrix metallopeptidase 21
Synonyms
MMRRC Submission 039834-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1804 (G1)
Quality Score213
Status Validated
Chromosome7
Chromosomal Location133674270-133680061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 133678882 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 120 (P120T)
Ref Sequence ENSEMBL: ENSMUSP00000113853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033278] [ENSMUST00000122136]
Predicted Effect probably benign
Transcript: ENSMUST00000033278
AA Change: P120T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000033278
Gene: ENSMUSG00000030981
AA Change: P120T

DomainStartEndE-ValueType
Pfam:PG_binding_1 46 107 5.6e-13 PFAM
low complexity region 117 133 N/A INTRINSIC
ZnMc 166 327 2.67e-32 SMART
HX 332 390 1.97e-1 SMART
HX 393 448 5.36e-6 SMART
HX 450 497 9.33e-6 SMART
HX 505 548 1.11e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122136
AA Change: P120T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113853
Gene: ENSMUSG00000030981
AA Change: P120T

DomainStartEndE-ValueType
Pfam:PG_binding_1 46 107 1.9e-13 PFAM
low complexity region 117 133 N/A INTRINSIC
ZnMc 166 327 2.67e-32 SMART
Pfam:Hemopexin 351 390 4.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131894
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.5%
  • 20x: 89.8%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. Mice harboring certain mutations in this gene exhibit congenital heart defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit heterotaxia and congenital cardiovascular defects including d-loop transposition of the great arteries, tricupid valve atresia, and ventricular septal defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,203 Y220H probably benign Het
2610507B11Rik A G 11: 78,273,469 H1165R probably damaging Het
4930579C12Rik T C 9: 89,152,060 noncoding transcript Het
Abcc8 T C 7: 46,120,479 S871G probably benign Het
Acly T C 11: 100,515,905 Y288C probably damaging Het
Adgrb1 T A 15: 74,529,540 D128E probably damaging Het
AF529169 T A 9: 89,603,099 M82L possibly damaging Het
Alms1 C T 6: 85,621,275 Q1497* probably null Het
Cacna1c G A 6: 118,687,046 T688M probably damaging Het
Ccdc7a A T 8: 128,988,766 L279* probably null Het
Cep135 A G 5: 76,636,932 E958G probably benign Het
Clec4n G T 6: 123,230,022 V2L possibly damaging Het
Col28a1 C T 6: 8,164,612 probably null Het
Dcaf5 A G 12: 80,339,829 S508P probably benign Het
Dlgap2 C A 8: 14,727,809 N351K possibly damaging Het
Dnah8 T A 17: 30,708,407 Y1346N probably benign Het
Dqx1 T C 6: 83,060,322 V322A probably damaging Het
Ebf3 A C 7: 137,200,521 L412V possibly damaging Het
Epha5 T C 5: 84,331,815 N110S probably benign Het
Fcgbp T C 7: 28,086,139 C334R probably benign Het
Glp1r T A 17: 30,930,713 probably null Het
Gm4952 G T 19: 12,618,420 R58L probably damaging Het
Gm7579 G A 7: 142,211,938 C27Y unknown Het
Golm1 T A 13: 59,642,389 probably null Het
Gucy2g T A 19: 55,210,309 I801F probably benign Het
H2-D1 T C 17: 35,263,552 Y83H probably damaging Het
Homez A T 14: 54,857,141 I19N probably damaging Het
Hoxa5 T C 6: 52,202,648 K249R probably damaging Het
Hsd17b4 A T 18: 50,177,984 N550Y probably damaging Het
Ipo4 A T 14: 55,629,456 N668K probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klb A G 5: 65,379,853 D842G probably damaging Het
Mroh7 T A 4: 106,694,392 I918F possibly damaging Het
Muc5b A G 7: 141,863,780 T3488A possibly damaging Het
Npc1 C T 18: 12,223,088 C42Y probably damaging Het
Ogdh A G 11: 6,338,565 Y214C probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr1277 T C 2: 111,269,930 M146V probably benign Het
Olfr450 G A 6: 42,818,221 C250Y possibly damaging Het
Olfr726 A T 14: 50,083,902 W260R probably damaging Het
Olfr930 A G 9: 38,930,650 T160A possibly damaging Het
Phtf1 A G 3: 103,987,567 probably benign Het
Plb1 A G 5: 32,353,697 N1302S possibly damaging Het
Prex2 A G 1: 11,132,342 K492E probably damaging Het
Prkaa1 A G 15: 5,178,778 D509G probably benign Het
Rims2 C T 15: 39,437,043 Q57* probably null Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rraga A G 4: 86,576,444 I176V probably damaging Het
Rrm2 T C 12: 24,708,612 I51T probably benign Het
Serpina3a T A 12: 104,118,416 probably benign Het
Skint7 T C 4: 111,982,012 W168R probably damaging Het
Slc27a4 A G 2: 29,811,267 M357V probably benign Het
Slc4a3 A G 1: 75,551,717 H452R probably damaging Het
Smc1b A T 15: 85,127,790 I127K possibly damaging Het
Snap91 T A 9: 86,783,417 M383L probably benign Het
Taf6l A T 19: 8,773,634 L52Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tas2r124 A G 6: 132,755,525 I266V probably benign Het
Tesk2 T C 4: 116,800,621 probably benign Het
Tmem131l T G 3: 83,910,479 Q1237P possibly damaging Het
Tmem67 A G 4: 12,045,789 probably null Het
Tnfaip8 T A 18: 50,090,661 C179S probably damaging Het
Ush2a G A 1: 188,633,729 probably null Het
Vps13b A T 15: 35,917,137 E3709V probably damaging Het
Wdr7 A T 18: 63,865,440 S1153C probably damaging Het
Zc2hc1b A C 10: 13,171,268 probably benign Het
Zfp438 A G 18: 5,213,689 I423T probably damaging Het
Zfp592 C A 7: 81,023,695 P136T probably damaging Het
Zfp783 T A 6: 47,945,885 noncoding transcript Het
Zfp804b A T 5: 6,771,756 S400T possibly damaging Het
Other mutations in Mmp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Mmp21 APN 7 133675914 missense probably damaging 1.00
IGL02822:Mmp21 APN 7 133676099 missense possibly damaging 0.80
IGL03240:Mmp21 APN 7 133674571 missense probably damaging 0.97
IGL03261:Mmp21 APN 7 133674674 missense probably benign 0.01
R0659:Mmp21 UTSW 7 133677667 splice site probably benign
R1037:Mmp21 UTSW 7 133674453 missense probably benign 0.16
R1463:Mmp21 UTSW 7 133675859 splice site probably null
R1523:Mmp21 UTSW 7 133679045 missense probably benign
R1710:Mmp21 UTSW 7 133677285 missense probably damaging 1.00
R1848:Mmp21 UTSW 7 133677153 missense probably benign 0.05
R2993:Mmp21 UTSW 7 133678986 missense probably damaging 1.00
R3431:Mmp21 UTSW 7 133678750 missense probably benign 0.00
R4790:Mmp21 UTSW 7 133675030 missense probably damaging 1.00
R4870:Mmp21 UTSW 7 133678677 missense probably damaging 1.00
R5134:Mmp21 UTSW 7 133679013 missense probably benign 0.00
R5347:Mmp21 UTSW 7 133675922 missense probably benign
R5682:Mmp21 UTSW 7 133674629 missense probably benign 0.00
R5905:Mmp21 UTSW 7 133678714 missense probably benign 0.17
R6028:Mmp21 UTSW 7 133678714 missense probably benign 0.17
R6936:Mmp21 UTSW 7 133678975 missense probably benign 0.01
R7657:Mmp21 UTSW 7 133678833 missense probably benign 0.00
R7702:Mmp21 UTSW 7 133679062 missense probably damaging 1.00
R7786:Mmp21 UTSW 7 133675035 missense probably benign
Z1177:Mmp21 UTSW 7 133674933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTCATCCCCAGAGAGTTG -3'
(R):5'- TGGCTGGTCAGAGATACCTAGC -3'

Sequencing Primer
(F):5'- TGTAGGCATCTCCCACCAG -3'
(R):5'- TGGTCAGAGATACCTAGCCCAAAG -3'
Posted On2014-06-23