Incidental Mutation 'R1804:Snap91'
ID203392
Institutional Source Beutler Lab
Gene Symbol Snap91
Ensembl Gene ENSMUSG00000033419
Gene Namesynaptosomal-associated protein 91
SynonymsF1-20, AP180, 91kDa
MMRRC Submission 039834-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.883) question?
Stock #R1804 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location86765923-86880654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86783417 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 383 (M383L)
Ref Sequence ENSEMBL: ENSMUSP00000074095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036347] [ENSMUST00000074468] [ENSMUST00000074501] [ENSMUST00000098495]
Predicted Effect probably benign
Transcript: ENSMUST00000036347
AA Change: M676L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046189
Gene: ENSMUSG00000033419
AA Change: M676L

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 3.27e-5 PROSPERO
internal_repeat_1 584 611 3.27e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 728 757 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 850 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074468
AA Change: M676L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000074066
Gene: ENSMUSG00000033419
AA Change: M676L

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 6.86e-5 PROSPERO
internal_repeat_1 584 611 6.86e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
low complexity region 733 762 N/A INTRINSIC
low complexity region 833 847 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074501
AA Change: M383L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000074095
Gene: ENSMUSG00000033419
AA Change: M383L

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 355 382 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 440 469 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000098495
AA Change: M641L
SMART Domains Protein: ENSMUSP00000096096
Gene: ENSMUSG00000033419
AA Change: M641L

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 396 426 N/A INTRINSIC
low complexity region 432 459 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
low complexity region 492 551 N/A INTRINSIC
internal_repeat_1 552 579 4.67e-5 PROSPERO
internal_repeat_1 577 604 4.67e-5 PROSPERO
low complexity region 609 627 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
low complexity region 698 727 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
low complexity region 820 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192170
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.5%
  • 20x: 89.8%
Validation Efficiency 96% (77/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display postnatal growth retardation, limb clasping, altered behavior, defects in synaptic vesicle reformation, impaired neurotransmission, excitatory/inhibitory imbalance, epileptic seizures, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,203 Y220H probably benign Het
2610507B11Rik A G 11: 78,273,469 H1165R probably damaging Het
4930579C12Rik T C 9: 89,152,060 noncoding transcript Het
Abcc8 T C 7: 46,120,479 S871G probably benign Het
Acly T C 11: 100,515,905 Y288C probably damaging Het
Adgrb1 T A 15: 74,529,540 D128E probably damaging Het
AF529169 T A 9: 89,603,099 M82L possibly damaging Het
Alms1 C T 6: 85,621,275 Q1497* probably null Het
Cacna1c G A 6: 118,687,046 T688M probably damaging Het
Ccdc7a A T 8: 128,988,766 L279* probably null Het
Cep135 A G 5: 76,636,932 E958G probably benign Het
Clec4n G T 6: 123,230,022 V2L possibly damaging Het
Col28a1 C T 6: 8,164,612 probably null Het
Dcaf5 A G 12: 80,339,829 S508P probably benign Het
Dlgap2 C A 8: 14,727,809 N351K possibly damaging Het
Dnah8 T A 17: 30,708,407 Y1346N probably benign Het
Dqx1 T C 6: 83,060,322 V322A probably damaging Het
Ebf3 A C 7: 137,200,521 L412V possibly damaging Het
Epha5 T C 5: 84,331,815 N110S probably benign Het
Fcgbp T C 7: 28,086,139 C334R probably benign Het
Glp1r T A 17: 30,930,713 probably null Het
Gm4952 G T 19: 12,618,420 R58L probably damaging Het
Gm7579 G A 7: 142,211,938 C27Y unknown Het
Golm1 T A 13: 59,642,389 probably null Het
Gucy2g T A 19: 55,210,309 I801F probably benign Het
H2-D1 T C 17: 35,263,552 Y83H probably damaging Het
Homez A T 14: 54,857,141 I19N probably damaging Het
Hoxa5 T C 6: 52,202,648 K249R probably damaging Het
Hsd17b4 A T 18: 50,177,984 N550Y probably damaging Het
Ipo4 A T 14: 55,629,456 N668K probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klb A G 5: 65,379,853 D842G probably damaging Het
Mmp21 G T 7: 133,678,882 P120T probably benign Het
Mroh7 T A 4: 106,694,392 I918F possibly damaging Het
Muc5b A G 7: 141,863,780 T3488A possibly damaging Het
Npc1 C T 18: 12,223,088 C42Y probably damaging Het
Ogdh A G 11: 6,338,565 Y214C probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr1277 T C 2: 111,269,930 M146V probably benign Het
Olfr450 G A 6: 42,818,221 C250Y possibly damaging Het
Olfr726 A T 14: 50,083,902 W260R probably damaging Het
Olfr930 A G 9: 38,930,650 T160A possibly damaging Het
Phtf1 A G 3: 103,987,567 probably benign Het
Plb1 A G 5: 32,353,697 N1302S possibly damaging Het
Prex2 A G 1: 11,132,342 K492E probably damaging Het
Prkaa1 A G 15: 5,178,778 D509G probably benign Het
Rims2 C T 15: 39,437,043 Q57* probably null Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rraga A G 4: 86,576,444 I176V probably damaging Het
Rrm2 T C 12: 24,708,612 I51T probably benign Het
Serpina3a T A 12: 104,118,416 probably benign Het
Skint7 T C 4: 111,982,012 W168R probably damaging Het
Slc27a4 A G 2: 29,811,267 M357V probably benign Het
Slc4a3 A G 1: 75,551,717 H452R probably damaging Het
Smc1b A T 15: 85,127,790 I127K possibly damaging Het
Taf6l A T 19: 8,773,634 L52Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tas2r124 A G 6: 132,755,525 I266V probably benign Het
Tesk2 T C 4: 116,800,621 probably benign Het
Tmem131l T G 3: 83,910,479 Q1237P possibly damaging Het
Tmem67 A G 4: 12,045,789 probably null Het
Tnfaip8 T A 18: 50,090,661 C179S probably damaging Het
Ush2a G A 1: 188,633,729 probably null Het
Vps13b A T 15: 35,917,137 E3709V probably damaging Het
Wdr7 A T 18: 63,865,440 S1153C probably damaging Het
Zc2hc1b A C 10: 13,171,268 probably benign Het
Zfp438 A G 18: 5,213,689 I423T probably damaging Het
Zfp592 C A 7: 81,023,695 P136T probably damaging Het
Zfp783 T A 6: 47,945,885 noncoding transcript Het
Zfp804b A T 5: 6,771,756 S400T possibly damaging Het
Other mutations in Snap91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Snap91 APN 9 86821737 missense probably benign 0.01
IGL01147:Snap91 APN 9 86798558 missense probably benign 0.37
IGL01358:Snap91 APN 9 86806560 missense probably damaging 1.00
IGL01501:Snap91 APN 9 86838125 missense probably damaging 0.99
IGL01883:Snap91 APN 9 86775612 missense probably damaging 1.00
IGL02632:Snap91 APN 9 86839522 missense possibly damaging 0.94
IGL02864:Snap91 APN 9 86838088 missense possibly damaging 0.95
IGL03276:Snap91 APN 9 86825012 missense possibly damaging 0.78
PIT4514001:Snap91 UTSW 9 86879433 missense possibly damaging 0.86
R1564:Snap91 UTSW 9 86792196 missense possibly damaging 0.85
R1840:Snap91 UTSW 9 86815465 missense probably damaging 1.00
R1869:Snap91 UTSW 9 86790141 critical splice acceptor site probably null
R2156:Snap91 UTSW 9 86825077 missense probably damaging 1.00
R2221:Snap91 UTSW 9 86792527 missense possibly damaging 0.53
R2223:Snap91 UTSW 9 86792527 missense possibly damaging 0.53
R2233:Snap91 UTSW 9 86798571 missense probably benign 0.23
R2680:Snap91 UTSW 9 86879550 start codon destroyed probably null 1.00
R3077:Snap91 UTSW 9 86838854 missense possibly damaging 0.95
R3702:Snap91 UTSW 9 86806520 missense probably damaging 0.99
R3840:Snap91 UTSW 9 86839565 missense probably damaging 1.00
R3912:Snap91 UTSW 9 86792557 missense possibly damaging 0.53
R3913:Snap91 UTSW 9 86792557 missense possibly damaging 0.53
R3958:Snap91 UTSW 9 86838130 missense probably damaging 1.00
R3963:Snap91 UTSW 9 86775612 missense probably damaging 1.00
R4043:Snap91 UTSW 9 86777049 missense probably damaging 1.00
R4133:Snap91 UTSW 9 86777049 missense probably damaging 1.00
R4641:Snap91 UTSW 9 86879475 missense probably damaging 1.00
R4674:Snap91 UTSW 9 86792017 missense possibly damaging 0.73
R4770:Snap91 UTSW 9 86773601 missense possibly damaging 0.86
R4798:Snap91 UTSW 9 86783454 intron probably benign
R4849:Snap91 UTSW 9 86792560 missense possibly damaging 0.53
R4991:Snap91 UTSW 9 86790154 splice site probably null
R5200:Snap91 UTSW 9 86815444 missense probably damaging 1.00
R5354:Snap91 UTSW 9 86835124 missense possibly damaging 0.84
R5644:Snap91 UTSW 9 86790153 splice site probably null
R6029:Snap91 UTSW 9 86825080 splice site probably null
R6091:Snap91 UTSW 9 86839628 missense probably damaging 1.00
R6175:Snap91 UTSW 9 86825000 missense probably damaging 1.00
R6191:Snap91 UTSW 9 86838052 missense probably damaging 1.00
R6611:Snap91 UTSW 9 86790127 missense probably benign 0.33
R6764:Snap91 UTSW 9 86792181 missense probably benign 0.33
R6881:Snap91 UTSW 9 86773593 missense possibly damaging 0.73
R7201:Snap91 UTSW 9 86790146 splice site probably null
R7223:Snap91 UTSW 9 86879557 start gained probably benign
R7247:Snap91 UTSW 9 86792616 missense unknown
R7327:Snap91 UTSW 9 86773545 missense unknown
R7520:Snap91 UTSW 9 86839649 missense probably damaging 1.00
R7572:Snap91 UTSW 9 86806494 missense possibly damaging 0.58
R7616:Snap91 UTSW 9 86839621 missense probably damaging 1.00
R7690:Snap91 UTSW 9 86824978 missense possibly damaging 0.95
R7750:Snap91 UTSW 9 86798709 splice site probably null
X0027:Snap91 UTSW 9 86798828 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGAGGTAAAGGCCATTATC -3'
(R):5'- AGGTTCACTAACGTGTGTGC -3'

Sequencing Primer
(F):5'- CCATTATCAGAAGGAGGAAGAGTGTC -3'
(R):5'- GGTTCACTAACGTGTGTGCATCATAC -3'
Posted On2014-06-23